#. and C. S. , Bonnet 1,2,3,4,# , Peggy Tilly 1,2,3,4 , Hélène Vitet 8 , Chantal Weber 1,2,3,4 , Carlos A, Christel Thauvin-Robinet, vol.9, issue.11, 2007.

A. Département-de-génétique and H. De-la-pitié-salpêtrière,

, Groupe de Recherche Clinique (GRC) "déficience intellectuelle et autisme

, Centre de Référence Déficiences Intellectuelles de Causes Rares Hôpital de la Pitié-Salpêtrière

. Univ, . Alpes, . Inserm, . U1216, and . Chu-grenoble-alpes, Grenoble Institut Neuroscience

, Texas Children's Hospital

. Genedx,

, Centre de Référence Anomalies du Développement et Syndromes Malformatifs, Fédération Hospitalo-Universitaire Médecine Translationnelle et Anomalies du Développement (TRANSLAD)

G. Equipe and I. Lnc-umr-1231,

, Boston Children's Hospital

. Inserm,

, Centre de Référence Déficiences Intellectuelles de Causes Rares

, References 1. Hirokawa, N. Kinesin and dynein superfamily proteins and the mechanism of organelle transport, Science, vol.279, pp.519-545, 1998.

N. Hirokawa and Y. Tanaka, Kinesin superfamily proteins (KIFs): Various functions and their relevance for important phenomena in life and diseases, Exp Cell Res, vol.334, pp.16-25, 2015.

A. Carabalona, D. J. Hu, and R. B. Vallee, KIF1A inhibition immortalizes brain stem cells but blocks BDNF-mediated neuronal migration, Nat Neurosci, vol.19, pp.253-62, 2016.

J. L. Chen, C. H. Chang, and J. W. Tsai, Gli2 Rescues Delays in Brain Development Induced by Kif3a Dysfunction, Cereb Cortex, 2018.

P. Foerster, mTORC1 signaling and primary cilia are required for brain ventricle morphogenesis, Development, vol.144, pp.201-210, 2017.

D. Sun, Regulation of neural stem cell proliferation and differentiation by Kinesin family member 2a, PLoS One, vol.12, p.179047, 2017.

J. W. Tsai, W. N. Lian, S. Kemal, A. R. Kriegstein, and R. B. Vallee, Kinesin 3 and cytoplasmic dynein mediate interkinetic nuclear migration in neural stem cells, Nat Neurosci, vol.13, pp.1463-71, 2010.

S. L. Wilson, J. P. Wilson, C. Wang, B. Wang, and S. K. Mcconnell, Primary cilia and Gli3 activity regulate cerebral cortical size, Dev Neurobiol, vol.72, pp.1196-212, 2012.

A. Geng, KIF20A/MKLP2 regulates the division modes of neural progenitor cells during cortical development, Nat Commun, vol.9, p.2707, 2018.

K. M. Janisch, The vertebrate-specific Kinesin-6, Kif20b, is required for normal cytokinesis of polarized cortical stem cells and cerebral cortex size, Development, vol.140, pp.4672-82, 2013.

M. L. Reilly, Loss of function mutations in KIF14 cause severe microcephaly and kidney development defects in humans and zebrafish, Hum Mol Genet, 2018.
URL : https://hal.archives-ouvertes.fr/inserm-02263778

A. Falnikar, S. Tole, and P. W. Baas, Kinesin-5, a mitotic microtubule-associated motor protein, modulates neuronal migration, Mol Biol Cell, vol.22, pp.1561-74, 2011.

A. Falnikar, S. Tole, M. Liu, J. S. Liu, and P. W. Baas, Polarity in migrating neurons is related to a mechanism analogous to cytokinesis, Curr Biol, vol.23, pp.1215-1235, 2013.

N. Homma, Kinesin superfamily protein 2A (KIF2A) functions in suppression of collateral branch extension, Cell, vol.114, pp.229-268, 2003.

M. Liu, Kinesin-12, a mitotic microtubule-associated motor protein, impacts axonal growth, navigation, and branching, J Neurosci, vol.30, pp.14896-906, 2010.

K. A. Myers and P. W. Baas, Kinesin-5 regulates the growth of the axon by acting as a brake on its microtubule array, J Cell Biol, vol.178, pp.1081-91, 2007.

D. Peretti, L. Peris, S. Rosso, S. Quiroga, and A. Caceres, Evidence for the involvement of KIF4 in the anterograde transport of L1-containing vesicles, J Cell Biol, vol.149, pp.141-52, 2000.

M. Xu, Kinesin-12 influences axonal growth during zebrafish neural development, Cytoskeleton (Hoboken), vol.71, pp.555-63, 2014.

S. Laguesse, E. Peyre, and L. Nguyen, Progenitor genealogy in the developing cerebral cortex, Cell Tissue Res, vol.359, pp.17-32, 2015.

B. J. Molyneaux, P. Arlotta, J. R. Menezes, and J. D. Macklis, Neuronal subtype specification in the cerebral cortex, Nat. Rev. Neurosci, vol.8, pp.427-437, 2007.

C. Ohtaka-maruyama and H. Okado, Molecular Pathways Underlying Projection Neuron Production and Migration during Cerebral Cortical Development, Front. Neurosci, vol.9, 2015.

E. Peyre, C. G. Silva, and L. Nguyen, Crosstalk between intracellular and extracellular signals regulating interneuron production, migration and integration into the cortex, Front Cell Neurosci, vol.9, p.129, 2015.

N. Hirokawa, S. Niwa, and Y. Tanaka, Molecular motors in neurons: transport mechanisms and roles in brain function, development, and disease, Neuron, vol.68, pp.610-638, 2010.

N. Hirokawa and Y. Tanaka, Kinesin superfamily proteins (KIFs): Various functions and their relevance for important phenomena in life and diseases, Exp. Cell Res, vol.334, pp.16-25, 2015.

K. Poirier, Mutations in TUBG1, DYNC1H1, KIF5C and KIF2A cause malformations of cortical development and microcephaly, Nat. Genet, vol.45, pp.639-647, 2013.
URL : https://hal.archives-ouvertes.fr/inserm-00838073

P. Makrythanasis, Biallelic variants in KIF14 cause intellectual disability with microcephaly

, J. Hum. Genet, vol.26, pp.330-339, 2018.

A. Moawia, Mutations of KIF14 cause primary microcephaly by impairing cytokinesis

. Neurol, , vol.82, p.577, 2017.

M. L. Reilly, Loss of function mutations in KIF14 cause severe microcephaly and kidney development defects in humans and zebrafish, Hum. Mol. Genet, 2018.
URL : https://hal.archives-ouvertes.fr/inserm-02263778

P. Ostergaard, Mutations in KIF11 cause autosomal-dominant microcephaly variably associated with congenital lymphedema and chorioretinopathy, Am. J. Hum. Genet, vol.90, pp.356-362, 2012.

J. M. Robitaille, Phenotypic overlap between familial exudative vitreoretinopathy and microcephaly, lymphedema, and chorioretinal dysplasia caused by KIF11 mutations, JAMA Ophthalmol, vol.132, pp.1393-1399, 2014.

M. J. Konjikusic, Mutations in Kinesin family member 6 reveal specific role in ependymal cell ciliogenesis and human neurological development, PLoS Genet, vol.14, p.1007817, 2018.

M. Cavallin, Recurrent KIF2A mutations are responsible for classic lissencephaly, Neurogenetics, vol.18, pp.73-79, 2017.
URL : https://hal.archives-ouvertes.fr/hal-01808075

G. Tian, A patient with lissencephaly, developmental delay, and infantile spasms, due to de novo heterozygous mutation of KIF2A, Mol Genet Genomic Med, vol.4, pp.599-603, 2016.

S. Michels, Mutations of KIF5C cause a neurodevelopmental disorder of infantile-onset epilepsy, absent language, and distinctive malformations of cortical development, Am. J. Med. Genet. A, vol.173, pp.3127-3131, 2017.

M. Cavallin, Recurrent KIF5C mutation leading to frontal pachygyria without microcephaly

, Neurogenetics, vol.17, pp.79-82, 2016.

A. Putoux, KIF7 mutations cause fetal hydrolethalus and acrocallosal syndromes, Nat. Genet, vol.43, pp.601-606, 2011.

I. Filges, Exome sequencing identifies mutations in KIF14 as a novel cause of an autosomal recessive lethal fetal ciliopathy phenotype, Clin. Genet, vol.86, pp.220-228, 2014.

M. H. Willemsen, Involvement of the kinesin family members KIF4A and KIF5C in intellectual disability and synaptic function, Journal of Medical Genetics, vol.51, pp.487-494, 2014.

S. Alsahli, KIF16B is a candidate gene for a novel autosomal-recessive intellectual disability syndrome, Am. J. Med. Genet. A, vol.176, pp.1602-1609, 2018.

A. Ibisler, Novel KIF7 Mutation in a Tunisian Boy with Acrocallosal Syndrome: Case Report and Review of the Literature, Mol Syndromol, vol.6, pp.173-180, 2015.

P. J. Tomaselli, A de novo dominant mutation in KIF1A associated with axonal neuropathy, spasticity and autism spectrum disorder, J. Peripher. Nerv. Syst, vol.22, pp.460-463, 2017.

J. R. Marszalek, J. A. Weiner, S. J. Farlow, J. Chun, and L. S. Goldstein, Novel dendritic kinesin sorting identified by different process targeting of two related kinesins: KIF21A and KIF21B, J. Cell Biol, vol.145, pp.469-479, 1999.

M. Muhia, The Kinesin KIF21B Regulates Microtubule Dynamics and Is Essential for Neuronal Morphology, Synapse Function, and Learning and Memory, Cell Rep, vol.15, pp.968-977, 2016.

A. E. Ghiretti, Activity-Dependent Regulation of Distinct Transport and Cytoskeletal Remodeling Functions of the Dendritic Kinesin KIF21B, Neuron, vol.92, pp.857-872, 2016.

D. Labonté, TRIM3 regulates the motility of the kinesin motor protein KIF21B, PLoS ONE, vol.8, p.75603, 2013.

J. Lipka, L. C. Kapitein, J. Jaworski, and C. C. Hoogenraad, Microtubule-binding protein doublecortinlike kinase 1 (DCLK1) guides kinesin-3-mediated cargo transport to dendrites, The EMBO Journal, vol.35, pp.302-318, 2016.

W. E. Van-riel, Kinesin-4 KIF21B is a potent microtubule pausing factor, Elife, vol.6, 2017.

K. V. Gromova, Neurobeachin and the Kinesin KIF21B Are Critical for Endocytic Recycling of NMDA Receptors and Regulate Social Behavior, Cell Rep, vol.23, pp.2705-2717, 2018.

S. Swarnkar, Y. Avchalumov, B. L. Raveendra, E. Grinman, S. V. Puthanveettil et al.,

, Proteins Kif11 and Kif21B Act as Inhibitory Constraints of Excitatory Synaptic Transmission Through Distinct Mechanisms, Sci Rep, vol.8, p.17419, 2018.

M. Morikawa, Y. Tanaka, H. Cho, M. Yoshihara, and N. Hirokawa, The Molecular Motor KIF21B

, Mediates Synaptic Plasticity and Fear Extinction by Terminating Rac1 Activation, Cell Rep, vol.23, pp.3864-3877, 2018.

M. Kannan, WD40-repeat 47, a microtubule-associated protein, is essential for brain development and autophagy, Proc. Natl. Acad. Sci. U.S.A, vol.114, pp.9308-9317, 2017.
URL : https://hal.archives-ouvertes.fr/hal-02378716

I. Leshchyns'ka and V. Sytnyk, Isolation of Growth Cones from Mouse Brain, BIO-PROTOCOL, vol.3, 2013.

E. W. Dent, S. L. Gupton, and F. B. Gertler, The Growth Cone Cytoskeleton in Axon Outgrowth and Guidance, Cold Spring Harb Perspect Biol, vol.3, 2011.

T. Matsuda and C. L. Cepko, Controlled expression of transgenes introduced by in vivo electroporation

, Proc. Natl. Acad. Sci. U.S.A, vol.104, pp.1027-1032, 2007.

H. M. Chu, Kar3 interaction with Cik1 alters motor structure and function, EMBO J, vol.24, pp.3214-3223, 2005.

J. G. Barrett, B. D. Manning, and M. Snyder, The Kar3p kinesin-related protein forms a novel heterodimeric structure with its associated protein Cik1p, Mol. Biol. Cell, vol.11, pp.2373-2385, 2000.

A. Bellion, J. Baudoin, C. Alvarez, M. Bornens, and C. Métin, Nucleokinesis in tangentially migrating neurons comprises two alternating phases: forward migration of the Golgi/centrosome associated with centrosome splitting and myosin contraction at the rear, J. Neurosci, vol.25, pp.5691-5699, 2005.

Y. V. Nishimura, Y. Nabeshima, and T. Kawauchi, Morphological and Molecular Basis of Cytoplasmic Dilation and Swelling in Cortical Migrating Neurons, Brain Sci, vol.7, 2017.

S. Tielens, J. D. Godin, and L. Nguyen, Real-time Recordings of Migrating Cortical Neurons from GFP and Cre Recombinase Expressing Mice, Curr Protoc Neurosci, vol.74, pp.3-29, 2016.

J. D. Godin, p27(Kip1) is a microtubule-associated protein that promotes microtubule polymerization during neuron migration, Dev. Cell, vol.23, pp.729-744, 2012.

J. Stenman, H. Toresson, and K. Campbell, Identification of two distinct progenitor populations in the lateral ganglionic eminence: implications for striatal and olfactory bulb neurogenesis, J. Neurosci, vol.23, pp.167-174, 2003.

W. C. Skarnes, A conditional knockout resource for the genome-wide study of mouse gene function, Nature, vol.474, pp.337-342, 2011.

, Chrystelle Po, vol.5, 2004.

U. Icube, . De-strasbourg, . Cnrs, . Fmts, and F. Strasbourg, Rational Previous work revealed that Kif21b homozygous (Kif21b -/-) knock-out

S. C. Collins, A Method for Parasagittal Sectioning for Neuroanatomical Quantification of Brain Structures in the Adult Mouse, Curr Protoc Mouse Biol, vol.8, p.48, 2018.

Y. L. Wu and C. W. Lo, Diverse Application of Magnetic Resonance Imaging for Mouse Phenotyping

, Birth Defects Res, vol.109, pp.758-770, 2017.

M. A. Horsfield and D. K. Jones, Applications of diffusion-weighted and diffusion tensor MRI to white matter diseases -a review, NMR Biomed, vol.15, pp.570-577, 2002.

S. Song, Dysmyelination revealed through MRI as increased radial (but unchanged axial) diffusion of water, Neuroimage, vol.17, pp.1429-1436, 2002.

S. Song, Demyelination increases radial diffusivity in corpus callosum of mouse brain

, Neuroimage, vol.26, pp.132-140, 2005.

R. Kumar, P. M. Macey, M. A. Woo, and R. M. Harper, Rostral brain axonal injury in congenital central hypoventilation syndrome, J. Neurosci. Res, vol.88, pp.2146-2154, 2010.

A. Goris, S. Boonen, M. D'hooghe, and B. Dubois, Replication of KIF21B as a susceptibility locus for multiple sclerosis, J. Med. Genet, vol.47, pp.775-776, 2010.

K. L. Kreft, Abundant kif21b is associated with accelerated progression in neurodegenerative diseases, Acta Neuropathol Commun, vol.2, p.144, 2014.

A. O. Dulamea, Role of Oligodendrocyte Dysfunction in Demyelination, Remyelination and Neurodegeneration in Multiple Sclerosis, Adv. Exp. Med. Biol, vol.958, pp.91-127, 2017.

S. E. Nasrabady, B. Rizvi, J. E. Goldman, and A. M. Brickman, White matter changes in Alzheimer's disease: a focus on myelin and oligodendrocytes, Acta Neuropathol Commun, vol.6, 2018.

S. Goebbels, Genetic targeting of principal neurons in neocortex and hippocampus of NEX-Cre mice, Genesis, vol.44, pp.611-621, 2006.

M. Zawadzka, CNS-resident glial progenitor/stem cells produce Schwann cells as well as oligodendrocytes during repair of CNS demyelination, Cell Stem Cell, vol.6, pp.578-590, 2010.

?. Benjelloun-touimi, S. Jacque, C. M. Derer, P. De-vitry, F. Maunoury et al., Evidence that mouse astrocytes may be derived from the radial glia. An immunohistochemical study of the cerebellum in the normal and reeler mouse, J. Neuroimmunol, vol.9, pp.87-97, 1985.

C. Bertipaglia, J. C. Gonçalves, R. B. Vallee, M. Betizeau, V. Cortay et al., Precursor diversity and complexity of lineage relationships in the outer subventricular zone of the primate, Semin. Cell Dev. Biol, vol.82, pp.442-457, 2013.

S. Bianchi, W. E. Van-riel, S. H. Kraatz, N. Olieric, D. Frey et al., Spinophilin facilitates dephosphorylation of doublecortin by PP1 to mediate microtubule bundling at the axonal wrist, Nat. Neurosci, vol.6, pp.1002-1012, 2005.

K. Bilgüvar, A. K. Oztürk, A. Louvi, K. Y. Kwan, M. Choi et al., Whole-exome sequencing identifies recessive WDR62 mutations in severe brain malformations, J. Cell Biol, vol.467, pp.11-17, 1985.

H. H. Bock, P. May, H. H. Bock, Y. Jossin, P. Liu et al., Novel transcription factor Satb2 interacts with matrix attachment region DNA elements in a tissue-specific manner and demonstrates cell-type-dependent expression in the developing mouse CNS, Histochemistry of glycogen deposition in perinatal rat brain: importance of radial glial cells, vol.10, pp.749-757, 1132.

K. R. ?-brunden, B. Zhang, J. Carroll, Y. Yao, J. S. Potuzak et al., Epothilone D improves microtubule density, axonal integrity, and cognition in a transgenic mouse model of tauopathy, J. Neurosci, vol.30, pp.13861-13866, 2010.

D. W. Buster, D. H. Baird, W. Yu, J. M. Solowska, M. Chauvière et al., Expression of the mitotic kinesin Kif15 in postmitotic neurons: implications for neuronal migration and development, J. Neurocytol, vol.32, pp.591-604, 2003.

,. ?-chen, C. Chang, and J. Tsai, Gli2 Rescues Delays in Brain Development Induced by Kif3a Dysfunction, Cereb Cortex, vol.29, pp.751-764, 2019.

L. Chen, G. Liao, R. R. Waclaw, K. A. Burns, D. Linquist et al., Rac1 controls the formation of midline commissures and the competency of tangential migration in ventral telencephalic neurons, J. Neurosci, vol.27, pp.3884-3893, 2007.

N. Chen, Y. Bao, Y. Xue, Y. Sun, D. Hu et al., Meta-analyses of RELN variants in neuropsychiatric disorders, Behav. Brain Res, vol.332, pp.110-119, 2017.

,. ?-chen, S. Gehler, A. E. Shaw, J. R. Bamburg, P. C. Letourneau et al., Cdc42 participates in the regulation of ADF/cofilin and retinal growth cone filopodia by brain derived neurotrophic factor, Journal of Neurobiology, vol.66, pp.11883-11888, 2002.

Y. Choe, J. A. Siegenthaler, and S. J. Pleasure, A Cascade of Morphogenic Signaling Initiated by the Meninges Controls Corpus Callosum Formation, Neuron, vol.73, pp.698-712, 2012.

Y. Choi, P. Liu, S. K. Sze, C. Dai, R. Z. Qi et al., Satb1 Is an Activity-Modulated Transcription Factor Required for the Terminal Differentiation and Connectivity of Medial Ganglionic Eminence-Derived Cortical Interneurons, The Journal of Cell Biology, vol.191, pp.17690-17705, 1996.

D. Cohen, M. Segal, and O. Reiner, Doublecortin Supports the Development of Dendritic Arbors in Primary Hippocampal Neurons. DNE, Developmental Dynamics, vol.30, pp.117-145, 2001.

C. H. Coles, F. Bradke, . R677-r691, C. Conde, A. Cáceres et al., The tubulin-binding sequence of brain microtubule-associated proteins, tau and MAP-2, is also involved in actin binding, Coordinating Neuronal Actin-Microtubule Dynamics, vol.25, pp.3667-3671, 1990.

C. ?-creppe, L. Malinouskaya, M. Volvert, M. Gillard, P. Close et al., Elongator controls the migration and differentiation of cortical neurons through acetylation of alpha-tubulin, Cell, vol.136, pp.551-564, 2009.

?. Cunha-ferreira, I. Chazeau, A. Buijs, R. R. Stucchi, R. Will et al., Ambient GABA Promotes Cortical Entry of Tangentially Migrating Cells Derived from the Medial Ganglionic Eminence, J. Clin. Invest, vol.24, pp.3-7, 2004.

G. ?-d'arcangelo, R. K. Dave, T. Ellis, M. C. Toumpas, J. P. Robson et al., Sonic hedgehog and notch signaling can cooperate to regulate neurogenic divisions of neocortical progenitors, Int. Rev. Neurobiol, vol.71, pp.1701-1708, 2005.

?. Martínez-cerdeño, V. Noctor, S. C. Martinez-garay, I. Gil-sanz, C. Franco et al., Cadherin 2/4 signaling via PTP1B and catenins is crucial for nucleokinesis during radial neuronal migration in the neocortex, Front Neuroanat, vol.8, pp.2121-2134, 2014.

?. Martínez-martínez, M. Á. Ciceri, G. Espinós, A. Fernández, V. Marín et al., Xenopus cytoplasmic linkerassociated protein 1 (XCLASP1) promotes axon elongation and advance of pioneer microtubules, Cell cycle dependence of laminar determination in developing neocortex, vol.527, pp.282-285, 1991.

F. J. Mcnally and A. Mecak, Microtubule-severing enzymes: From cellular functions to molecular mechanism, J. Cell Biol, vol.217, pp.4057-4069, 2018.

K. C. Mcneely, T. D. Cupp, J. N. Little, K. M. Janisch, A. Shrestha et al., , 2017.

A. Meixner, S. Haverkamp, H. Wässle, S. Führer, J. Thalhammer et al., Mutations of KIF5C cause a neurodevelopmental disorder of infantile-onset epilepsy, absent language, and distinctive malformations of cortical development, Kif20b causes defects in cortical neuron polarization and morphogenesis, vol.12, pp.9-10, 2000.

H. Miki, M. Setou, K. Kaneshiro, N. Hirokawa, H. Miki et al., All kinesin superfamily protein, KIF, genes in mouse and human, Genome Res, vol.98, pp.1455-1465, 2001.

B. D. Mitchell, J. D. Macklis, T. Miyamoto, K. Hosoba, H. Ochiai et al., Evidence for activity-dependent cortical wiring: formation of interhemispheric connections in neonatal mouse visual cortex requires projection neuron activity, Journal of Comparative Neurology, vol.482, pp.410-424, 2001.

K. Mizutani, K. Yoon, L. Dang, A. Tokunaga, N. Gaiano et al., Mutant huntingtin affects cortical progenitor cell division and development of the mouse neocortex, Ann. Neurol, vol.449, pp.10034-10040, 2007.

B. J. Molyneaux, P. Arlotta, T. Hirata, M. Hibi, J. D. Macklis et al., Fezl Is Required for the Birth and Specification of Corticospinal Motor Neurons, Novartis Found. Symp, vol.47, pp.427-437, 2005.

B. Y. Monroy, D. L. Sawyer, B. E. Ackermann, M. M. Borden, T. C. Tan et al., Balanced Vav2 GEF activity regulates neurite outgrowth and branching in vitro and in vivo, Mol. Cell. Neurosci, vol.9, pp.118-128, 2010.

A. T. Moore, K. E. Rankin, G. Von-dassow, L. Peris, M. Wagenbach et al., MCAK associates with the tips of polymerizing microtubules, Pathogenic huntingtin inhibits fast axonal transport by activating JNK3 and phosphorylating kinesin, vol.169, pp.864-871, 2004.
URL : https://hal.archives-ouvertes.fr/inserm-00380214

M. Morikawa, Y. Tanaka, H. Cho, M. Yoshihara, N. Hirokawa et al., Kinesin-1 tail autoregulation and microtubule-binding regions function in saltatory transport but not ooplasmic streaming, Development, vol.23, pp.1087-1092, 2011.

F. Muhammad, S. Mahmood-baig, L. Hansen, M. Sajid-hussain, I. Anjum-inayat et al., Compound heterozygous ASPM mutations in Pakistani MCPH families, Am. J. Med. Genet. A, vol.149, pp.926-930, 2009.

M. Muhia, E. Thies, D. Labonté, A. E. Ghiretti, K. V. Gromova et al., The Kinesin KIF21B Regulates Microtubule Dynamics and Is Essential for Neuronal Morphology, Synapse Function, and Learning and Memory, J. Neurosci, vol.15, pp.3792-3811, 2011.

S. Murthy, M. Niquille, N. Hurni, G. Limoni, S. Frazer et al., Kinesin-5 regulates the growth of the axon by acting as a brake on its microtubule array, J. Cell Biol, vol.5, pp.1081-1091, 2007.

V. C. Nadar, A. Ketschek, K. A. Myers, G. Gallo, and P. W. Baas, Kinesin-5 is essential for growth-cone turning, Curr. Biol, vol.18, pp.1972-1977, 2008.

B. Nadarajah, J. E. Brunstrom, J. Grutzendler, R. O. Wong, A. L. Pearlman et al., Two modes of radial migration in early development of the cerebral cortex, Nat. Neurosci, vol.4, pp.218-224, 2001.

T. Nagano, S. Morikubo, M. Sato, H. Nakagawa, K. Koyama et al., Local application of neurotrophins specifies axons through inositol 1,4,5-trisphosphate, calcium, and Ca2+/calmodulin-dependent protein kinases, Filamin A and FILIP (Filamin A-Interacting Protein) Regulate Cell Polarity and Motility in Neocortical Subventricular and Intermediate Zones during Radial Migration, vol.24, pp.814-829, 2000.

M. Namihira, J. Kohyama, K. Semi, T. Sanosaka, B. Deneen et al., Committed neuronal precursors confer astrocytic potential on residual neural precursor cells, Dev. Cell, vol.16, pp.220-228, 2008.

D. ?-neukirchen and F. Bradke, Neuronal polarization and the cytoskeleton, Seminars in Cell & Developmental Biology, vol.22, pp.825-833, 2011.

D. ?-neukirchen and F. Bradke, Cytoplasmic linker proteins regulate neuronal polarization through microtubule and growth cone dynamics, J. Neurosci, vol.31, pp.1528-1538, 2011.

J. Ng, L. Luo, J. Ng, T. Nardine, M. Harms et al., A novel role for CAMKII? in the regulation of cortical neuron migration: implications for neurodevelopmental disorders, Rho GTPases Regulate Axon Growth through Convergent and Divergent Signaling Pathways, vol.44, pp.3540-3550, 2002.

Y. V. Nishimura, Y. Nabeshima, T. Kawauchi, C. Nishioka, H. Liang et al., Cdk5 is required for multipolar-to-bipolar transition during radial neuronal migration and proper dendrite development of pyramidal neurons in the cerebral cortex, Morphological and Molecular Basis of Cytoplasmic Dilation and Swelling in Cortical Migrating Neurons, vol.7, pp.1152-1157, 1996.

Y. Okada, H. Yamazaki, Y. Sekine-aizawa, N. Hirokawa, Y. Okada et al., The neuron-specific kinesin superfamily protein KIF1A is a unique monomeric motor for anterograde axonal transport of synaptic vesicle precursors, Nature, vol.81, pp.769-780, 1995.

, Micro-duplications of 1q32.1 associated with neurodevelopmental delay, European Journal of Medical Genetics, vol.55, pp.145-150

?. O'neill, A. C. Kyrousi, C. Einsiedler, M. Burtscher, I. Drukker et al., Mutations in KIF11 cause autosomal-dominant microcephaly variably associated with congenital lymphedema and chorioretinopathy, Front. Cell. Neurosci, vol.12, pp.11186-11195, 2008.

G. Ou, O. E. Blacque, J. J. Snow, M. R. Leroux, and J. M. Scholey, Functional coordination of intraflagellar transport motors, Nature, vol.436, pp.583-587, 2005.

,. ?-papandréou, C. Leterrier, J. T. ;-?-paridaen, and W. B. Huttner, Neurogenesis during development of the vertebrate central nervous system, Molecular and Cellular Neuroscience, vol.91, pp.351-364, 2014.

J. T. ?-paridaen, M. Wilsch-bräuninger, W. B. Huttner, J. H. Park, A. Mecak et al., Asymmetric inheritance of centrosomeassociated primary cilium membrane directs ciliogenesis after cell division, Current Opinion in Neurobiology, vol.155, pp.1892-1906, 2006.

M. Peckham, L. Peris, M. Bisbal, J. Martinez-hernandez, Y. Saoudi et al., Crosstalk between intracellular and extracellular signals regulating interneuron production, migration and integration into the cortex. Front Cell Neurosci 9, Biochem. Soc. Trans, vol.39, pp.989-995, 2007.

L. Pinto, D. Drechsel, M. Schmid, J. Ninkovic, M. Irmler et al., Live imaging of individual cell divisions in mouse neuroepithelium shows asymmetry in cilium formation and Sonic hedgehog response. Cilia 1, Nature Neuroscience, vol.12, pp.1229-1237, 2009.

, Neuropilin 1-Sema Signaling Regulates Crossing of Cingulate Pioneering Axons during Development of the Corpus Callosum, Cereb Cortex, vol.19, pp.11-21

F. Pirozzi, B. Nelson, and G. Mirzaa, From microcephaly to megalencephaly: determinants of brain size, Dialogues Clin Neurosci, vol.20, pp.267-282, 2018.

R. Pla, V. Borrell, N. Flames, and O. Marín, Layer acquisition by cortical GABAergic interneurons is independent of Reelin signaling, J. Neurosci, vol.26, pp.6924-6934, 2006.

K. Poirier, Y. Saillour, N. Bahi-buisson, X. H. Jaglin, C. Fallet-bianco et al., Mutations in the neuronal ß-tubulin subunit TUBB3 result in malformation of cortical development and neuronal migration defects, Hum. Mol. Genet, vol.19, pp.4462-4473, 2010.

K. Poirier, Y. Saillour, F. Fourniol, F. Francis, I. Souville et al., Expanding the spectrum of TUBA1A-related cortical dysgenesis to Polymicrogyria, Eur. J. Hum. Genet, vol.21, pp.381-385, 2013.

K. Poirier, N. Lebrun, L. Broix, G. Tian, Y. Saillour et al., A novel CNS gene required for neuronal migration and involved in X-linked subcortical laminar heterotopia and lissencephaly syndrome, Molecular and Cellular Neuroscience, vol.45, pp.167-186, 1925.

K. J. Powell, S. E. Hori, R. Leslie, A. Andrieux, H. Schellinck et al., GDNF and GFRalpha1 promote differentiation and tangential migration of cortical GABAergic neurons, Behav. Neurosci, vol.121, pp.701-713, 2005.

A. Purohit, S. H. Tynan, R. Vallee, S. J. Doxsey, A. Putoux et al., Direct Interaction of Pericentrin with Cytoplasmic Dynein Light Intermediate Chain Contributes to Mitotic Spindle Organization, The Journal of Cell Biology, vol.147, pp.3120-3129, 1999.

M. A. ?-rabadán, J. Cayuso, G. Le-dréau, C. Cruz, M. Barzi et al., Basic fibroblast growth factor (Fgf2) is necessary for cell proliferation and neurogenesis in the developing cerebral cortex, Cell Death and Differentiation, vol.19, pp.5012-5023, 2000.

P. ?-rakic, M. Rallu, R. Machold, N. Gaiano, J. G. Corbin et al., Neuron-glia relationship during granule cell migration in developing cerebellar cortex. A Golgi and electronmicroscopic study in Macacus Rhesus, Avicenna J Med Biotechnol, vol.141, pp.273-276, 1971.

R. L. Ramos, J. Bai, J. J. Loturco, B. G. Rash, L. J. Richards et al., Germinal zones in the developing cerebral cortex of ferret: ontogeny, cell cycle kinetics, and diversity of progenitors, Journal of Comparative Neurology, vol.16, pp.2039-2054, 2001.

M. L. Reilly, M. F. Stokman, V. Magry, C. Jeanpierre, M. Alves et al., Loss of function mutations in KIF14 cause severe microcephaly and kidney development defects in humans and zebrafish, Hum. Mol. Genet, vol.115, pp.11933-11942, 2018.
URL : https://hal.archives-ouvertes.fr/inserm-02263778

L. J. Richards, W. E. Van-riel, A. Rai, S. Bianchi, E. A. Katrukha et al., Phenotypic overlap between familial exudative vitreoretinopathy and microcephaly, lymphedema, and chorioretinal dysplasia caused by KIF11 mutations, Cux1 Enables Interhemispheric Connections of Layer II/III Neurons by Regulating Kv1-Dependent Firing, vol.35, pp.494-506, 1995.

B. Roger, J. Al-bassam, L. Dehmelt, R. A. Milligan, S. Halpain et al., Formin 2 regulates the stabilization of filopodial tip adhesions in growth cones and affects neuronal outgrowth and pathfinding in vivo, MAP2c, but not tau, binds and bundles F-actin via its microtubule binding domain, vol.14, pp.2457-2473, 2004.

J. E. ?-san-miguel-ruiz, P. C. Letourneau, C. Sánchez-huertas, F. Freixo, R. Viais et al., The level of the transcription factor Pax6 is essential for controlling the balance between neural stem cell self-renewal and neurogenesis, J. Neurosci, vol.34, pp.11932-11948, 2009.

S. Sasaki, A. Shionoya, M. Ishida, M. J. Gambello, J. Yingling et al., Biallelic loss of human CTNNA2, encoding ?N-catenin, leads to ARP2/3 complex overactivity and disordered cortical neuronal migration, A LIS1/NUDEL/cytoplasmic dynein heavy chain complex in the developing and adult nervous system, vol.28, pp.2892-2902, 1979.

E. S. Seeley, M. V. Nachury, A. Seitz, H. Kojima, K. Oiwa et al., Single-molecule investigation of the interference between kinesin, tau and MAP2c, J. Cell. Sci, vol.123, pp.4896-4905, 2002.

K. Sekine, T. Honda, T. Kawauchi, K. Kubo, and K. Nakajima, The Outermost Region of the Developing Cortical Plate Is Crucial for Both the Switch of the Radial Migration Mode and the Dab1-Dependent "Inside-Out" Lamination in the Neocortex, J. Neurosci, vol.31, pp.9426-9439, 2011.

K. Sekine, T. Kawauchi, K. Kubo, T. Honda, J. Herz et al., Tbr2 directs conversion of radial glia into basal precursors and guides neuronal amplification by indirect neurogenesis in the developing neocortex, LKB1/STRAD promotes axon initiation during neuronal polarization, vol.76, pp.565-577, 1986.

Q. Shen, Y. Wang, J. T. Dimos, C. A. Fasano, T. N. Phoenix et al., The timing of cortical neurogenesis is encoded within lineages of individual progenitor cells, Nat. Neurosci, vol.9, pp.743-751, 2006.

M. Shikanai, K. Nakajima, and T. Kawauchi, N-Cadherin regulates radial glial fiber-dependent migration of cortical locomoting neurons, Communicative & Integrative Biology, vol.4, pp.326-330, 2011.

Y. Shikata, T. Okada, M. Hashimoto, T. Ellis, D. Matsumaru et al., Oblique radial glial divisions in the developing mouse neocortex induce self-renewing progenitors outside the germinal zone that resemble primate outer subventricular zone progenitors, J. Neurosci, vol.349, pp.3683-3695, 2011.

T. Shu and L. J. Richards, Cortical Axon Guidance by the Glial Wedge during the Development of the Corpus Callosum, J. Neurosci, vol.21, pp.2749-2758, 2001.

T. Shu, A. C. Puche, and L. J. Richards, Development of midline glial populations at the corticoseptal boundary, Journal of Neurobiology, vol.57, pp.81-94, 2003.

T. Shu, R. Ayala, M. Nguyen, Z. Xie, J. G. Gleeson et al., Ndel1 Operates in a Common Pathway with LIS1 and Cytoplasmic Dynein to Regulate Cortical Neuronal Positioning, e19. ? Sirajuddin, vol.44, pp.227-238, 2004.

K. C. Slep, S. L. Rogers, S. L. Elliott, H. Ohkura, P. A. Kolodziej et al., Unique morphological features of the proliferative zones and postmitotic compartments of the neural epithelium giving rise to striate and extrastriate cortex in the monkey, The Journal of Cell Biology, vol.168, pp.125-136, 1109.

V. Soppina, S. R. Norris, A. S. Dizaji, M. Kortus, S. Veatch et al., Dimerization of mammalian kinesin-3 motors results in superprocessive motion, Structure, and Development. Cell, vol.111, pp.226-247, 2014.

E. R. Sowell, S. N. Mattson, P. M. Thompson, T. L. Jernigan, E. P. Riley et al., The actin nucleating Arp2/3 complex contributes to the formation of axonal filopodia and branches through the regulation of actin patch precursors to filopodia, Developmental Neurobiology, vol.57, pp.747-758, 2001.

M. Spillane, A. Ketschek, C. J. Donnelly, A. Pacheco, J. L. Twiss et al., Nerve growth factor-induced formation of axonal filopodia and collateral branches involves the intra-axonal synthesis of regulators of the actinnucleating Arp2/3 complex, J. Neurosci, vol.32, pp.17671-17689, 2012.

M. Spillane, A. Ketschek, T. T. Merianda, J. L. Twiss, G. Gallo et al., Mitochondria coordinate sites of axon branching through localized intra-axonal protein synthesis, Cell Rep, vol.5, pp.485-502, 2013.

S. Srivatsa, S. Parthasarathy, Z. Molnár, and V. Tarabykin, Sip1 downstream Effector ninein controls neocortical axonal growth, ipsilateral branching, and microtubule growth and stability, Neuron, vol.85, pp.998-1012, 2015.

K. Stamer, R. Vogel, E. Thies, E. Mandelkow, E. Mandelkow et al., Heterogeneity in ventricular zone neural precursors contributes to neuronal fate diversity in the postnatal neocortex, Axon Extension Occurs Independently of Centrosomal Microtubule Nucleation. Science, vol.156, pp.704-707, 2002.

R. S. Stowers, L. J. Megeath, J. Górska-andrzejak, I. A. Meinertzhagen, T. L. Schwarz et al., Pax6-dependent regulation of adhesive patterning, R-cadherin expression and boundary formation in developing forebrain, Novel Drosophila Protein. Neuron, vol.36, pp.4027-4044, 1997.

K. Visscher, M. J. Schnitzer, S. M. Block, D. Vogt, R. F. Hunt et al., Lhx6 directly regulates Arx and CXCR7 to determine cortical interneuron fate and laminar position, Schizophr Bull, vol.400, pp.969-978, 1999.

S. Wahl, H. Barth, T. Ciossek, K. Aktories, and B. K. Mueller, Ephrin-A5 Induces Collapse of Growth Cones by Activating Rho and Rho Kinase, The Journal of Cell Biology, vol.149, pp.263-270, 2000.

G. B. Walters, O. Gustafsson, G. Sveinbjornsson, V. K. Eiriksdottir, A. B. Agustsdottir et al., MAP1B mutations cause intellectual disability and extensive white matter deficit, Nature Reviews Neuroscience, vol.9, pp.299-309, 2017.

X. Wang and T. L. Schwarz, The Mechanism of Ca2+-Dependent Regulation of Kinesin-Mediated Mitochondrial Motility, Cell, vol.136, pp.163-174, 2009.

C. Wang, L. Zhang, Y. Zhou, J. Zhou, X. Yang et al., Hedgehog signaling promotes basal progenitor expansion and the growth and folding of the neocortex, Nat. Neurosci, vol.27, pp.888-896, 2007.

P. Wang, F. Chou, S. Ramachandran, S. Xia, H. Chen et al., Asymmetric centrosome inheritance maintains neural progenitors in the neocortex, Development, vol.143, pp.947-955, 2009.

X. Wang, J. Tsai, B. Lamonica, and A. R. Kriegstein, A new subtype of progenitor cell in the mouse embryonic neocortex, Nature Neuroscience, vol.14, pp.555-561, 2011.

T. Watanabe, S. Wang, J. Noritake, K. Sato, M. Fukata et al., Interaction with IQGAP1 Links APC to Rac1, Cdc42, and Actin Filaments during Cell Polarization and Migration, Developmental Cell, vol.7, pp.871-883, 2004.

J. ?-welagen, A. , S. Weng, Z. Shang, Y. Yao et al., Structural analyses of key features in the KANK1·KIF21A complex yield mechanistic insights into the cross-talk between microtubules and the cell cortex, Developmental Neurobiology, vol.71, pp.89-98, 1994.

M. H. Willemsen, L. E. Vissers, M. A. Willemsen, B. W. Van-bon, T. Kroes et al., Mutations in DYNC1H1 cause severe intellectual disability with neuronal migration defects, J. Med. Genet, vol.49, pp.179-183, 2012.

M. H. Willemsen, W. Ba, W. M. Wissink-lindhout, A. P. Brouwer, . De et al., Autosomal Recessive Primary Microcephaly (MCPH): A Review of Clinical, Molecular, and Evolutionary Findings, Journal of Medical Genetics, vol.51, pp.793-806, 2005.

M. J. Wozniak, M. Melzer, C. Dorner, H. Haring, R. Lammers et al., WAVE2-Abi2 Complex Controls Growth Cone Activity and Regulates the Multipolar-Bipolar Transition as well as the Initiation of Glia-Guided Migration, BMC Cell Biology, vol.6, pp.1410-1423, 2005.

Q. Xu, I. Cobos, E. D. Cruz, J. L. Rubenstein, A. et al., Sonic hedgehog signaling confers ventral telencephalic progenitors with distinct cortical interneuron fates, Centrosomin represses dendrite branching by orienting microtubule nucleation, vol.24, pp.1437-1445, 2004.

K. Yamada, C. Andrews, W. Chan, C. A. Mckeown, A. Magli et al., Heterozygous mutations of the kinesin KIF21A in congenital fibrosis of the extraocular muscles type 1 (CFEOM1), Nat. Genet, vol.35, pp.318-321, 2003.

K. H. Yamada, T. Hanada, A. H. Chishti, T. Yang, Y. Sun et al., The effector domain of human Dlg tumor suppressor acts as a switch that relieves autoinhibition of kinesin-3 motor GAKIN/KIF13B, Biochemistry, vol.46, pp.1097-1112, 2007.

K. W. Yau, S. F. Van-beuningen, I. Cunha-ferreira, B. M. Cloin, E. Y. Van-battum et al., Birth-date dependent alignment of GABAergic neurons occurs in a different pattern from that of non-GABAergic neurons in the developing mouse visual cortex, Neurosci. Res, vol.82, pp.5573-5583, 2004.

W. Yu, L. Qiang, J. M. Solowska, A. Karabay, S. Korulu et al., The microtubule-severing proteins spastin and katanin participate differently in the formation of axonal branches, Autosomal Recessive Primary Microcephaly (MCPH): An Update, vol.19, pp.135-142, 2008.

X. Zhang, J. Zhu, G. Yang, Q. Wang, L. Qian et al., NGF-induced axon growth is mediated by localized inactivation of GSK-3beta and functions of the microtubule plus end binding protein APC, J. Comp. Neurol, vol.9, pp.2714-2723, 2004.

C. Zimmer, M. Tiveron, R. Bodmer, H. Cremer, G. Zimmer et al., Dynamics of Cux2 expression suggests that an early pool of SVZ precursors is fated to become upper cortical layer neurons, European Journal of Neuroscience, vol.14, pp.62-73, 2004.
URL : https://hal.archives-ouvertes.fr/hal-00310874

L. Broix, L. Asselin, C. G. Silva, E. L. Ivanova, P. Tilly et al., Ciliogenesis and cell cycle alterations contribute to KIF2A-related malformations of cortical development, Human Molecular Genetics, vol.27, issue.2, pp.224-238, 2017.

, J'ai participé à l'étude du phénotype de migration radiaire induit par les variants humains de, vol.2

E. L. Ivanova, J. G. Gilet, V. Sulimenko, A. Duchon, G. Rudolf et al., TUBG1 missense variants underlying cortical malformations disrupt neuronal locomotion and microtubule dynamics but not neurogenesis, Nature Communications, vol.10, issue.1, p.2129, 2019.
URL : https://hal.archives-ouvertes.fr/hal-02388602

, J'ai participé à l'étude du phénotype de migration radiaire induit par les variants humains de TUBG1

C. G. Silva-6 and E. L. Ivanova, Nathalie Drouot, vol.5, 2004.

. Institut-de-gé-né-tique, ;. De-biologie-molé-culaire-et-cellulaire, C. Inserm-u1016, and . U8104, U7104, 3 INSERM U964, 4 Université de Strasbourg, vol.67400

S. Université, U. Pierre, and M. Curie, France and 13 Service de Diagnostic Gé né tique, vol.12

, Tel: þ33 3 88655624; Fax: þ33 3 88 65 32 01; Email: hinckelm@igbmc.fr Abstract Genetic findings reported by our group and others showed that de novo missense variants in the KIF2A gene underlie malformations of brain development called pachygyria and microcephaly. Though KIF2A is known as member of the Kinesin-13 family involved in the regulation of microtubule end dynamics through its ATP dependent MT-depolymerase activity, how KIF2A variants lead to brain malformations is still largely unknown. Using cellular and in utero electroporation approaches, we show here that KIF2A disease-causing variants disrupts projection neuron positioning and interneuron migration, as well as progenitors proliferation. Interestingly, further dissection of this latter process revealed that ciliogenesis regulation is also altered during progenitors cell cycle. Altogether, our data suggest that deregulation of the coupling between ciliogenesis and cell cycle might contribute to the pathogenesis of KIF2A-related brain malformations. They also raise the issue whether ciliogenesis defects are a hallmark of other brain malformations, such as those related to tubulins and MTmotor proteins variants, Department of Translational Medicine and Neurogenetics, 1, rue Laurent Fries, BP 10142, 67404 Illkirch Cedex, 2017.

, Human Molecular Genetics, vol.27, issue.2, pp.224-238, 2018.

, Advance Access Publication Date, 2017.

R. S. Desikan and A. J. Barkovich, Malformations of cortical development, Ann. Neurol, vol.80, pp.797-810, 2016.

V. Des-portes, F. Francis, J. M. Pinard, I. Desguerre, M. L. Moutard et al., ) doublecortin is the major gene causing X-linked subcortical laminar heterotopia (SCLH), Hum. Mol. Genet, vol.7, pp.1063-1070, 1998.

O. Reiner, R. Carrozzo, Y. Shen, M. Wehnert, F. Faustinella et al., Isolation of a Miller-Dieker lissencephaly gene containing G protein beta-subunit-like repeats, Nature, vol.364, pp.717-721, 1993.

J. G. Gleeson, K. M. Allen, J. W. Fox, E. D. Lamperti, S. Berkovic et al., Doublecortin, a brain-specific gene mutated in human X-linked lissencephaly and double cortex syndrome, encodes a putative signaling protein, Cell, vol.92, pp.63-72, 1998.

N. Bahi-buisson, I. Souville, F. J. Fourniol, A. Toussaint, C. A. Moores et al., New insights into genotype-phenotype correlations for the doublecortinrelated lissencephaly spectrum, Brain, vol.136, pp.223-244, 2013.

D. A. Keays, G. Tian, K. Poirier, G. Huang, C. Siebold et al., Mutations in alpha-tubulin cause abnormal neuronal migration in mice and lissencephaly in humans, Cell, vol.128, pp.45-57, 2007.

X. H. Jaglin and J. Chelly, Tubulin-related cortical dysgeneses: microtubule dysfunction underlying neuronal migration defects, Trends Genet, vol.25, pp.555-566, 2009.

M. Breuss, J. I. Heng, .. Poirier, K. Tian, G. Jaglin et al., Mutations in the b-tubulin gene TUBB5 cause microcephaly with structural brain abnormalities, Cell Rep, vol.2, pp.1554-1562, 2012.

K. Poirier, N. Lebrun, L. Broix, G. Tian, Y. Saillour et al., Mutations in TUBG1, DYNC1H1, KIF5C and KIF2A cause malformations of cortical development and microcephaly, Nat. Genet, vol.45, pp.639-647, 2013.
URL : https://hal.archives-ouvertes.fr/inserm-00838073

N. Bahi-buisson, K. Poirier, F. Fourniol, Y. Saillour, S. Valence et al., The wide spectrum of tubulinopathies: what are the key features for the diagnosis, Brain, vol.137, pp.1676-1700, 2014.

M. A. Tischfield, G. Y. Cederquist, M. L. Gupta, and E. C. Engle, Phenotypic spectrum of the tubulin-related disorders and functional implications of disease-causing mutations, Curr. Opin. Genet. Dev, vol.21, pp.286-294, 2011.

M. Breuss, T. Fritz, T. Gstrein, K. Chan, L. Ushakova et al., Mutations in the murine homologue of TUBB5 cause microcephaly by perturbing cell cycle progression and inducing p53-associated apoptosis, Development, vol.143, pp.1126-1133, 2016.

Y. Saillour, L. Broix, E. Bruel-jungerman, N. Lebrun, G. Muraca et al., Beta tubulin isoforms are not interchangeable for rescuing impaired radial migration due to Tubb3 knockdown, Hum. Mol. Genet, vol.23, pp.1516-1526, 2014.

M. Cavallin, E. K. Bijlsma, A. El-morjani, S. Moutton, E. A. Peeters et al., Recurrent KIF2A mutations are responsible for classic lissencephaly, Neurogenetics, vol.18, pp.73-79, 2017.
URL : https://hal.archives-ouvertes.fr/hal-01808075

G. Tian, A. G. Cristancho, H. A. Dubbs, G. T. Liu, N. J. Cowan et al., A patient with lissencephaly, developmental delay, and infantile spasms, due to de novo heterozygous mutation of KIF2A, Mol. Genet. Genomic Med, vol.4, pp.599-603, 2016.

A. Desai, S. Verma, T. J. Mitchison, and C. E. Walczak, Kin I kinesins are microtubule-destabilizing enzymes, Cell, vol.96, pp.69-78, 1999.

C. E. Walczak, S. Gayek, and R. Ohi, Microtubule-depolymerizing kinesins, Annu. Rev. Cell Dev. Biol, vol.29, pp.417-441, 2013.

S. C. Ems-mcclung and C. E. Walczak, Kinesin-13s in mitosis: Key players in the spatial and temporal organization of spindle microtubules, Semin. Cell Dev. Biol, vol.21, pp.276-282, 2010.

C. Jang, J. Wong, J. A. Coppinger, A. Seki, J. R. Yates et al., DDA3 recruits microtubule depolymerase Kif2a to spindle poles and controls spindle dynamics and mitotic chromosome movement, J. Cell Biol, vol.181, pp.255-267, 2008.

N. J. Ganem, K. Upton, and D. A. Compton, Efficient mitosis in human cells lacking poleward microtubule flux, Curr. Biol, vol.15, pp.1827-1832, 2005.

R. Uehara, Y. Tsukada, T. Kamasaki, I. Poser, K. Yoda et al., Aurora B and Kif2A control microtubule length for assembly of a functional central spindle during anaphase, J. Cell Biol, vol.202, pp.623-636, 2013.

H. J. Kwon, J. E. Park, H. Song, and C. Jang, DDA3 and Mdp3 modulate Kif2a recruitment onto the mitotic spindle to control minus-end spindle dynamics, J. Cell Sci, vol.129, pp.2719-2725, 2016.

A. L. Manning, N. J. Ganem, S. F. Bakhoum, M. Wagenbach, L. Wordeman et al., The kinesin-13 proteins Kif2a, Kif2b, and Kif2c/MCAK have distinct roles during mitosis in human cells, Mol. Biol. Cell, vol.18, pp.2970-2979, 2007.

N. Homma, Y. Takei, Y. Tanaka, T. Nakata, S. Terada et al., Kinesin superfamily protein 2A (KIF2A) functions in suppression of collateral branch extension, Cell, vol.114, pp.229-239, 2003.

M. Maor-nof, N. Homma, C. Raanan, A. Nof, N. Hirokawa et al., Axonal pruning is actively regulated by the microtubule-destabilizing protein kinesin superfamily protein 2A, Cell Rep, vol.3, pp.971-977, 2013.

Y. Noda, R. Sato-yoshitake, S. Kondo, M. Nangaku, and N. Hirokawa, KIF2 is a new microtubule-based anterograde motor that transports membranous organelles distinct from those carried by kinesin heavy chain or KIF3A/B, J. Cell Biol, vol.129, pp.157-167, 1995.

T. Miyamoto, K. Hosoba, H. Ochiai, E. Royba, H. Izumi et al., The Microtubule-Depolymerizing Activity of a Mitotic Kinesin Protein KIF2A Drives Primary Cilia Disassembly Coupled with Cell Proliferation, Cell Rep, vol.10, pp.664-673, 2015.

K. Bilgü-var, A. K. Rk, A. Louvi, K. Y. Kwan, M. Choi et al., Whole-exome sequencing identifies recessive WDR62 mutations in severe brain malformations, Nature, vol.467, pp.207-210, 2010.

D. V. Santos and . Dos, Regulation of neural stem cell proliferation and differentiation by apoptosis-relevant factors, vol.5, pp.1-17, 2012.

D. S. Barry, J. M. Pakan, and K. W. Mcdermott, Radial glial cells: key organisers in CNS development, Int. J. Biochem. Cell Biol, vol.46, pp.76-79, 2014.

O. Marín, M. Valiente, X. Ge, and L. Tsai, Guiding neuronal cell migrations, Cold Spring Harb. Perspect. Biol, vol.2, p.1834, 2010.

S. A. Fietz and W. B. Huttner, Cortical progenitor expansion, self-renewal and neurogenesis-a polarized perspective, Curr. Opin. Neurobiol, vol.21, pp.23-35, 2011.

A. Shitamukai and F. Matsuzaki, Control of asymmetric cell division of mammalian neural progenitors, Dev. Growth Differ, vol.54, pp.277-286, 2012.

N. J. Ganem and D. A. Compton, The KinI kinesin Kif2a is required for bipolar spindle assembly through a functional relationship with MCAK, J. Cell Biol, vol.166, pp.473-478, 2004.

E. M. Valente, R. O. Rosti, E. Gibbs, and J. G. Gleeson, Primary cilia in neurodevelopmental disorders, Nat. Rev. Neurol, vol.10, pp.27-36, 2014.

Y. Yang, C. Wang, and L. Van-aelst, DOCK7 interacts with TACC3 to regulate interkinetic nuclear migration and cortical neurogenesis, Nat. Neurosci, vol.15, pp.1201-1210, 2012.

J. Schenk, M. Wilsch-brauninger, F. Calegari, and W. B. Huttner, Myosin II is required for interkinetic nuclear migration of neural progenitors, Proc. Natl. Acad. Sci, vol.106, pp.16487-16492, 2009.

S. Jaillard, J. Andrieux, G. Plessis, A. C. Krepischi, J. Lucas et al., ) 5q12.1 deletion: Delineation of a phenotype including mental retardation and ocular defects, Am. J. Med. Genet., Part A, vol.155, pp.725-731, 2011.

C. A. Moores and R. A. Milligan, Lucky 13-microtubule depolymerisation by kinesin-13 motors, J. Cell Sci, vol.119, pp.3905-3913, 2006.

X. Jiang and J. Nardelli, Cellular and molecular introduction to brain development, Neurobiol. Dis, vol.92, pp.3-17, 2016.

A. R. Kriegstein and S. C. Noctor, Patterns of neuronal migration in the embryonic cortex, Trends Neurosci, vol.27, pp.392-399, 2004.

L. Tsai and J. G. Gleeson, Minireview Nucleokinesis in Neuronal Migration, Neuron, vol.46, pp.383-388, 2005.

J. I. Heng, .. Chariot, A. Nguyen, and L. , Molecular layers underlying cytoskeletal remodelling during cortical development, Trends Neurosci, vol.33, pp.38-47, 2010.

J. Bai, R. L. Ramos, J. B. Ackman, A. M. Thomas, R. V. Lee et al., RNAi reveals doublecortin is required for radial migration in rat neocortex, Nat. Neurosci, vol.6, pp.1277-1283, 2003.

J. Tsai, K. H. Bremner, and R. B. Vallee, Dual subcellular roles for LIS1 and dynein in radial neuronal migration in live brain tissue, Nat. Neurosci, vol.10, pp.970-979, 2007.

L. C. Greig, M. B. Woodworth, M. J. Galazo, H. Padmanabhan, and J. D. Macklis, Molecular logic of neocortical projection neuron specification, development and diversity, Nat. Rev. Neurosci, vol.14, pp.755-769, 2013.

I. Izawa, H. Goto, K. Kasahara, M. Inagaki, V. Singla et al., Current topics of functional links between primary cilia and cell cycle, Cilia, vol.4, p.12, 2015.

D. J. Doobin, S. Kemal, T. J. Dantas, and R. B. Vallee, Severe NDE1-mediated microcephaly results from neural progenitor cell cycle arrests at multiple specific stages, Nat. Commun, vol.7, pp.1-14, 2016.

A. Li, M. Saito, J. Chuang, Y. Tseng, C. Dedesma et al., Ciliary transition zone activation of phosphorylated Tctex-1 controls ciliary resorption, S-phase entry and fate of neural progenitors, Nat. Cell Biol, vol.13, pp.402-411, 2011.

D. Alcantara and M. O'driscoll, Congenital microcephaly, Am. J. Med. Genet. C. Semin. Med. Genet, vol.166, pp.124-139, 2014.

D. Jayaraman, A. Kodani, D. M. Gonzalez, J. D. Mancias, G. H. Mochida et al., Microcephaly Proteins Wdr62 and Aspm Define a Mother Centriole Complex Regulating Centriole Biogenesis, Apical Complex, and Cell Fate, Neuron, vol.92, pp.813-828, 2016.

E. Gabriel, A. Wason, A. Ramani, L. M. Gooi, P. Keller et al., CPAP promotes timely cilium disassembly to maintain neural progenitor pool, embo J, vol.35, pp.803-819, 2016.

D. U. Mick, R. B. Rodrigues, R. D. Leib, C. M. Adams, A. S. Chien et al., Proteomics of Primary Cilia by Proximity Labeling, Dev. Cell, vol.35, pp.497-512, 2015.

G. D. Gupta, É. Coyaud, J. Gonçalves, B. A. Mojarad, Y. Liu et al., A Dynamic Protein Interaction Landscape of the Human Centrosome-Cilium Interface, Cell, vol.163, pp.1484-1499, 2015.

K. Boldt, J. Van-reeuwijk, Q. Lu, K. Koutroumpas, T. T. Nguyen et al., An organelle-specific protein landscape identifies novel diseases and molecular mechanisms, Nat. Commun, vol.7, p.11491, 2016.

L. Ekaterina, , p.11, 2004.

, De novo heterozygous missense variants in the ?-tubulin gene TUBG1 have been linked to human malformations of cortical development associated with intellectual disability and epilepsy. Here, we investigated through in-utero electroporation and in-vivo studies, how four of these variants affect cortical development. We show that TUBG1 mutants affect neuronal positioning

. Institut-de-génétique, . De-biologie-moléculaire, and . Cellulaire, , vol.7104, p.67400

F. Illkirch, Institute of Molecular Genetics of the Czech Academy of Sciences, Víde?ská 1083, Biochimie et de Génétique Moléculaire, vol.142, issue.20, p.67000

P. Celphedia, I. Clinique-de-la, and S. , 11 These authors jointly supervised this work: Jamel Chelly, Maria-Victoria Hinckelmann. Correspondence and requests for materials should be addressed to M, p.67000

. Nature-communications-|, , vol.10, p.1234567890, 2019.

, and a pCAG-mScarlet vectors, kindly provided by Julien Courchet (Institut NeuroMyoGene, Lyon). pCAG-PAKT-mKO bearing the pericentrin-AKAp450 centrosomal targeting (PACT) domain fused to Kusabira Orange was kindly provided by

. Antibodies, The following antibodies were used in this study: ?-tubulin, pp.38-53

, GTU-88 (T6557, mouse, used at 1/10000 for WB and 1/1000 for IF/IHC

, Gamma-tubulin (434-451) TU-30 (ab27074, mouse, used at 1/1000, Abcam)

, GAPDH (MAB374, mouse, used at 1/1000, Chemicon)

, Cux1 (sc-13024, rabbit, used at 1/100

. Cux1, Proteintech, p.11733

, GFP (A10262, chicken, used at 1/1000, ThermoFisher)

, CTIP2 (ab18465, rat, used at 1/500, Abcam

, NeuN (MAB377, mouse, used at 1/500, Millipore)

, SATB2 (ab51502, mouse, used at 1/400, Abcam

, Abcam

. Pax6, Eurogentec

. Tbr2,

, Ki67 (NCL-L-Ki67-MM1, mouse, used at 1/500, Leica)

, Anti-tRFP (AB234, rabbit used at 1/5000 for WB, Evrogen

, GCP4 (sc-271876, mouse, used at 1/1000 for WB

, Anti-mouse antibody conjugated with HRP (W402B, goat, used at1/ 10000 for WB, Promega

, Anti-GCP2 antibody GCP2-01 (mouse monoclonal IgG2b) used for immunoprecipitation was described previously 58

, beads (GE-Health Care) saturated with (i) rabbit antibody to TagRFP, Anti-GCP2 antibody GCP2-02 (mouse monoclonal IgG1, in the form of hybriusing JA-25.50 rotor

, Equal amounts of lysates were then loaded on polyacrylamide gels and transferred onto nitrocellulose membranes. Membranes were blocked in 5% milk solution or 2% BSA in TBS-0.1% Tween and then incubated with the primary antibodies overnight at 4°C. HRP (horseradish)-conjugated secondary antibodies (Thermo Fischer) were used at 1:10000. Uncropped and unprocessed scans of blots can be found in Supplementary Fig. 12. Electron microscopy. Samples were immersed in glutaraldehyde (2.5%) and paraformaldehyde (2.5%) in cacodylate buffer (0.1 M, pH 7.4) and post-fixed in 1% osmium tetroxide, dehydrated through graded alcohol (50, 70, 90, and 100%) and propylene oxide for 30 min each, and embedded in Epon 812. Semithin sections were cut at 2 µm on an ultra microtome (Leica Ultracut UCT) and ultrathin sections were cut at 70 nm and contrasted with uranyl acetate and lead citrate and examined at 70 kv with a Morgagni 268D electron microscope (Phillips, FEI Electron Optics, Western blot. Cells were lysed in RIPA buffer (50 mM Tris-HCl, pH 7.7, 0.15 M NaCl, 1 mM EDTA and 1% Triton X-100) supplemented with proteases inhibitors (Roche)

, Samples were maintained at 37°C and 5% CO2 during acquisition. Images were collected with Photometrics Prime 95B? Scientific CMOS Camera (PHOTOMETRICS) every 200 ms during 2 min, EB3 tracking analyses. Patient's fibroblasts and HeLa cells were cultured in fluorodish? FD35-100 (World Precision Instruments) and transfected with EB3-GFP plasmid using Lipofectamine 2000 (Invitrogen) following manufacturer instructions

, Reaction conditions were carried out for 50 cycles (10 min Initial denaturation 95°C, 10 s at 95°C, 15 s at 60°C and 20 s at 72°C), each qRT-PCR reaction was performed in triplicate and relative mRNA expression was normalized to GAPDH for Tubg1 and Tubg2 comparisons and to Actin for mouse models. The following gene-specific primers were used for mouse ?-tubulin 1: Forward: 5?CCCAGGGAGAAAAAATCCACGAGGA3?; Reverse: 5?GAGCCCAAGCCAGA GCCTGTCC 3?; for mouse ?-tubulin 2: Forward: 5?GACCGAGAAGCAGATGG AG3?; Reverse: 5?CGTTCAGTCGCTCTAAGAGG3?. For mouse model validation, the following primers were used between exons 1 and 4 for KI mice: Forward 5?GAGGAGCGATGCCGAGAGAA3?, RNA was prepared in three independent isolations from the cortices of mouse embryos at different time points of development with TRIzol reagent (Thermo Fisher Scientific), and cDNA samples were synthetized with SuperScript II Reverse Transcriptase (Invitrogen), p.5

, In box plots center line represents the median, end of boxes 25th and 75th percentile and whiskers 10th and 90th percentiles. e Fear conditioning test. Graphs plot the freezing during the different sessions of the test. The 4 min of habituation (Hab1 and 2) and the 2 min post choc. The 6-min context session (Cont 1, 2, and 3) was run 24-h after conditioning. The 8-min cue session was performed 5-hours after the context session. A sequence of 2-min with no cue (pre cue1 and 2) and 2 min with light/auditory (cue 1 and 2) conditioning stimulus were repeated twice. Data are presented as mean ± s.e.m., n = 9 mice per genotype. One-way ANOVA (a, b, and d) or Two-way ANOVA, Tubg1 Y92C/+ mice present with behavioral abnormalities a, b Repetitive behaviours. Distance travelled (a) and occurrences of rearing (b) numbered during 10 min of observation in a novel home-cage environment showing a significant increase for Tubg1 Y92C/+ mice. c, d Novel object recognition (NOR) task

P. Rakic, Specification of cerebral cortical areas, Science, vol.241, pp.170-176, 1988.

S. A. Anderson, D. D. Eisenstat, L. Shi, and J. L. Rubenstein, Interneuron migration from basal forebrain to neocortex: dependence on Dlx genes, Science, vol.278, pp.15-18, 1997.

R. Guerrini and W. B. Dobyns, Malformations of cortical development: clinical features and genetic causes, Lancet Neurol, vol.13, pp.710-726, 2014.

F. Francis, Human disorders of cortical development: from past to present, Eur. J. Neurosci, vol.23, pp.877-893, 2006.

A. J. Barkovich, R. Guerrini, R. I. Kuzniecky, G. D. Jackson, and W. B. Dobyns, A developmental and genetic classification for malformations of cortical development: update 2012, Brain, vol.135, pp.1348-1369, 2012.

X. H. Jaglin and J. Chelly, Tubulin-related cortical dysgeneses: microtubule dysfunction underlying neuronal migration defects, Trends Genet, vol.25, pp.555-566, 2009.

N. Bahi-buisson, The wide spectrum of tubulinopathies: what are the key features for the diagnosis?, Brain, vol.137, pp.1676-1700, 2014.

J. Bond, A centrosomal mechanism involving CDK5RAP2 and CENPJ controls brain size, Nat. Genet, vol.37, pp.353-355, 2005.

M. S. Hussain, A truncating mutation of CEP135 causes primary microcephaly and disturbed centrosomal function, Am. J. Hum. Genet, vol.90, pp.871-878, 2012.

T. W. Yu, Mutations in WDR62, encoding a centrosome-associated protein, cause microcephaly with simplified gyri and abnormal cortical architecture, Nat. Genet, vol.42, pp.1015-1020, 2010.

D. L. Guernsey, Mutations in centrosomal protein CEP152 in primary microcephaly families linked to MCPH4, Am. J. Hum. Genet, vol.87, pp.40-51, 2010.

J. Bond, ASPM is a major determinant of cerebral cortical size, Nat. Genet, vol.32, pp.316-320, 2002.

A. Kumar, S. C. Girimaji, M. R. Duvvari, and S. H. Blanton, Mutations in STIL, encoding a pericentriolar and centrosomal protein, cause primary microcephaly, Am. J. Hum. Genet, vol.84, pp.286-290, 2009.

S. Brock, Tubulinopathies continued: refining the phenotypic spectrum associated with variants in TUBG1, Eur. J. Hum. Genet, vol.26, pp.1132-1142, 2018.

A. Yuba-kubo, A. Kubo, M. Hata, and S. Tsukita, Gene knockout analysis of two ?-tubulin isoforms in mice, Dev. Biol, vol.282, pp.361-373, 2005.

E. Dráberová, Differential expression of human ?-tubulin isotypes during neuronal development and oxidative stress points to a ?-tubulin-2 prosurvival function, FASEB J, vol.31, pp.1828-1846, 2017.

M. Moudjou, N. Bordes, M. Paintrand, and M. Bornens, gamma-Tubulin in mammalian cells: the centrosomal and the cytosolic forms, J. Cell. Sci, vol.109, pp.875-887, 1996.

S. Vinopal, ?-Tubulin 2 nucleates microtubules and is downregulated in mouse early embryogenesis, PLoS ONE, vol.7, p.29919, 2012.

T. Ohashi, T. Yamamoto, Y. Yamanashi, and M. Ohsugi, Human TUBG2 gene is expressed as two splice variant mRNA and involved in cell growth, FEBS Lett, vol.590, pp.1053-1063, 2016.

K. Oegema, Characterization of two related Drosophila ?-tubulin complexes that differ in their ability to nucleate microtubules, J. Cell. Biol, vol.144, pp.721-733, 1999.

M. Knop and E. Schiebel, Spc98p and Spc97p of the yeast gamma-tubulin complex mediate binding to the spindle pole body via their interaction with Spc110p, EMBO J, vol.16, pp.6985-6995, 1997.

J. M. Kollman, The structure of the gamma-tubulin small complex: implications of its architecture and flexibility for microtubule nucleation, Mol. Biol. Cell, vol.19, pp.207-215, 2008.

J. M. Kollman, A. Merdes, L. Mourey, and D. A. Agard, Microtubule nucleation by ?-tubulin complexes, Nat. Rev. Mol. Cell Biol, vol.12, pp.709-721, 2011.

X. Wang, R. Qiu, W. Tsark, and Q. Lu, Rapid promoter analysis in developing mouse brain and genetic labeling of young neurons by doublecortin-DsRedexpress, J. Neurosci. Res, vol.85, pp.3567-3573, 2007.

N. Galjart, Plus-end-tracking proteins and their interactions at microtubule ends, Curr. Biol, vol.20, pp.528-537, 2010.

S. C. Collins, A method for parasagittal sectioning for neuroanatomical quantification of brain structures in the adult mouse, Curr. Protoc. Mouse Biol, vol.8, p.48, 2018.

G. Li and S. J. Pleasure, The development of hippocampal cellular assemblies, Wiley Interdiscip. Rev. Dev. Biol, vol.3, pp.165-177, 2014.

R. A. Bevins and J. Besheer, Object recognition in rats and mice: a one-trial non-matching-to-sample learning task to study 'recognition memory, Nat. Protoc, vol.1, pp.1306-1311, 2006.

J. N. Crawley, Behavioral phenotyping of transgenic and knockout mice: experimental design and evaluation of general health, sensory functions, motor abilities, and specific behavioral tests, Brain Res, vol.835, pp.18-26, 1999.

W. Loscher, Critical review of current animal models of seizures and epilepsy used in the discovery and development of new antiepileptic drugs, Seizure, vol.20, pp.359-368, 2011.

C. E. Oakley and B. R. Oakley, Identification of gamma-tubulin, a new member of the tubulin superfamily encoded by mipA gene of Aspergillus nidulans, Nature, vol.338, pp.662-664, 1989.

C. Gueth-hallonet, Gamma-Tubulin is present in acentriolar MTOCs during early mouse development, J. Cell. Sci, vol.105, pp.157-166, 1993.

N. Donato and . Di, Analysis of 17 genes detects mutations in 81 % of 811 patients with lissencephaly, Genet. Med, vol.20, pp.1354-1364, 2018.

M. Faheem, Molecular genetics of human primary microcephaly: an overview, Bmc. Med. Genom, vol.8, pp.24-27, 2015.

J. C. Corbo, Doublecortin is required in mice for lamination of the hippocampus but not the neocortex, J. Neurosci, vol.22, pp.7548-7557, 2002.

D. A. Keays, Mutations in ?-Tubulin cause abnormal neuronal migration in mice and lissencephaly in humans, Cell, vol.128, pp.45-57, 2007.

T. Gstrein, Mutations in Vps15 perturb neuronal migration in mice and are associated with neurodevelopmental disease in humans, Nat. Neurosci, 2018.

R. W. Stottmann, Genes. Brain. Behav, vol.16, pp.250-259, 2016.

J. Bai, RNAi reveals doublecortin is required for radial migration in rat neocortex, Nat. Neurosci, vol.6, pp.1277-1283, 2003.

X. H. Jaglin, Mutations in the ?-tubulin gene TUBB2B result in asymmetrical polymicrogyria, Nat. Genet, vol.41, pp.746-752, 2009.
URL : https://hal.archives-ouvertes.fr/inserm-00404834

M. Wong and S. N. Roper, Genetic animal models of malformations of cortical development and epilepsy, J. Neurosci. Methods, vol.260, pp.73-82, 2016.

N. Chevassus-au-louis and A. Represa, The right neuron at the wrong place: Biology of heterotopic neurons in cortical neuronal migration disorders, with special reference to associated pathologies, Cell. Mol. Life Sci, vol.55, pp.1206-1215, 1999.

B. R. Oakley, C. E. Oakley, Y. Yoon, and M. K. Jung, Gamma-tubulin is a component of the spindle pole body that is essential for microtubule function in Aspergillus nidulans, Cell, vol.61, pp.1289-1301, 1990.

T. Stearns, L. Evans, and M. Kirschner, Gamma-tubulin is a highly conserved component of the centrosome, Cell, vol.65, pp.825-836, 1991.

H. C. Joshi, M. J. Palacios, L. Mcnamara, and D. W. Cleveland, Gammatubulin is a centrosomal protein required for cell cycle-dependent microtubule nucleation, Nature, vol.356, pp.80-83, 1992.

B. R. Oakley, Centrosomes and Microtubule Nucleation, Curr. Top. Dev. Biol, vol.49, pp.27-54, 2000.

C. Wiese and Y. Zheng, A new function for the gamma-tubulin ring complex as a microtubule minus-end cap, Nat. Cell Biol, vol.2, pp.358-364, 2000.

T. W. Hendrickson, J. Yao, S. Bhadury, A. H. Corbett, and H. C. Joshi, Conditional mutations in gamma-tubulin reveal its involvement in chromosome segregation and cytokinesis, Mol. Biol. Cell, vol.12, pp.2469-2481, 2001.

Y. Feng and C. A. Walsh, Mitotic spindle regulation by Nde1 controls cerebral cortical size, Neuron, vol.44, pp.279-293, 2004.

R. E. Mcintyre, Disruption of mouse cenpj, a regulator of centriole biogenesis, phenocopies seckel syndrome, PLoS Genet, vol.8, pp.1-18, 2012.

A. Bouissou, ?-Tubulin ring complexes regulate microtubule plus end dynamics, J. Cell. Biol, vol.187, pp.327-334, 2009.

J. L. Paluh, A mutation in gamma-tubulin alters microtubule dynamics and organization and is synthetically lethal with the kinesin-like protein pkl1p, Mol. Biol. Cell, vol.11, pp.1225-1239, 2000.

T. Chinen, The ?-tubulin-specific inhibitor gatastatin reveals temporal requirements of microtubule nucleation during the cell cycle, Nat. Commun, vol.6, pp.1-11, 2015.

C. Sánchez-huertas, Non-centrosomal nucleation mediated by augmin organizes microtubules in post-mitotic neurons and controls axonal microtubule polarity, Nat. Commun, vol.7, p.12187, 2016.

I. Cunha-ferreira, The HAUS complex is a key regulator of noncentrosomal microtubule organization during neuronal development, Cell Rep, vol.24, pp.791-800, 2018.

V. Sulimenko, Microtubule nucleation in mouse bone marrow-derived mast cells is regulated by the concerted action of GIT1/?PIX proteins and calcium, J. Immunol, vol.194, pp.4099-4111, 2015.

E. Dráberová, Overexpression and nucleolar localization of ?-tubulin small complex proteins GCP2 and GCP3 in glioblastoma, J. Neuropathol. Exp. Neurol, vol.74, pp.723-742, 2015.

Z. Hájková, STIM1-directed reorganization of microtubules in activated mast cells, J. Immunol, vol.186, pp.913-923, 2011.

V. Sulimenko, Association of brain ?-tubulins with ??-tubulin dimers, Biochem. J, vol.365, pp.889-895, 2002.

C. D. Katsetos, Altered cellular distribution and subcellular sorting of ?-tubulin in diffuse astrocytic gliomas and human glioblastoma cell lines, J. Neuropathol. Exp. Neurol, vol.65, pp.465-477, 2006.

H. Tabata and K. Nakajima, Efficient in utero gene transfer system to the developing mouse brain using electroporation: visualization of neuronal migration in the developing cortex, Neuroscience, vol.103, pp.865-872, 2001.

S. Tielens, J. D. Godin, and L. Nguyen, Real-time recordings of migrating cortical neurons from GFP and Cre recombinase expressing mice, Curr. Protoc. Neurosci, vol.74, pp.3-29, 2016.

M. Birling, A. Dierich, S. Jacquot, Y. Herault, and G. Pavlovic, Highlyefficient, fluorescent, locus directed cre and FlpO deleter mice on a pure C57BL/6N genetic background, Genesis, vol.50, pp.482-489, 2012.