E. G. Acosta, V. Castilla, and E. B. Damonte, Differential Requirements in Endocytic Trafficking for Penetration of Dengue Virus, PLoS One, vol.7, 2012.

N. J. Agard, J. A. Prescher, and C. R. Bertozzi, A strain-promoted [3 + 2] azide-alkyne cycloaddition for covalent modification of biomolecules in living systems, J. Am. Chem. Soc, vol.126, pp.15046-15047, 2004.

M. Agger, F. Scheutz, S. Villumsen, K. Mølbak, and A. M. Petersen, Antibiotic treatment of verocytotoxin-producing Escherichia coli (VTEC) infection: a systematic review and a proposal, J. Antimicrob. Chemother, vol.70, pp.2440-2446, 2015.

A. and V. , The functions of animal microRNAs, Nature, vol.431, pp.350-355, 2004.

M. Amessou, A. Fradagrada, T. Falguieres, J. M. Lord, D. C. Smith et al., Syntaxin 16 and syntaxin 5 are required for efficient retrograde transport of several exogenous and endogenous cargo proteins, J. Cell Sci, vol.120, pp.1457-1468, 2007.

W. Antonin, D. Fasshauer, S. Becker, R. Jahn, and T. R. Schneider, Crystal structure of the endosomal SNARE complex reveals common structural principles of all SNAREs, Nat. Struct. Biol, vol.9, pp.107-111, 2002.

B. Antonny, D. Madden, S. Hamamoto, L. Orci, and R. Schekman, Dynamics of the COPII coat with GTP and stable analogues, Nat Cell Biol, vol.3, pp.531-537, 2001.

J. F. Aranda, A. Canfran-duque, L. Goedeke, Y. Suarez, and C. Fernandez-hernando, The miR-199-dynamin regulatory axis controls receptor-mediated endocytosis, J. Cell Sci, vol.128, pp.3197-3209, 2015.

J. F. Aranda, S. J. Rathjen, L. Johannes, and C. Fernández-hernando, MiR-199a-5p attenuates retrograde transport and protects against Shiga toxin cytotoxicity, 2017.

A. Arce, A. Estirado, M. Ordobas, S. Sevilla, N. García et al., Re-emergence of Leishmaniasis in Spain: Community outbreak in, 2009.

. Eurosurveillance, , vol.18, p.20546

C. Bachert, C. Fimmel, and A. D. Linstedt, Endosomal trafficking and proprotein convertase cleavage of cis Golgi protein GP73 produces marker for hepatocellular carcinoma, Traffic, vol.8, pp.1415-1423, 2007.

C. Bachert, T. H. Lee, and A. D. Linstedt, Lumenal endosomal and Golgi-retrieval determinants involved in pH-sensitive targeting of an early Golgi protein, Mol. Biol. Cell, vol.12, pp.3152-60, 2001.

J. D. Bagert, Y. J. Xie, M. J. Sweredoski, Y. Qi, S. Hess et al., Quantitative, Time-Resolved Proteomic Analysis by Combining Bioorthogonal Noncanonical Amino Acid Tagging and Pulsed Stable Isotope Labeling by Amino Acids in Cell Culture, Mol. Cell. Proteomics, vol.13, pp.1352-1358, 2014.

S. I. Bannykh, T. Rowe, and W. E. Balch, The organization of endoplasmic reticulum export complexes, J. Cell Biol, vol.135, pp.19-35, 1996.

J. Barbier, C. Bouclier, L. Johannes, and D. Gillet, Inhibitors of the cellular trafficking of ricin, Toxins (Basel), vol.4, pp.15-27, 2012.

L. Barbieri, M. G. Battelli, and F. Stirpe, Ribosome-inactivating proteins from plants, BBA -Rev. Biomembr, vol.1154, issue.93, pp.90002-90008, 1993.

D. P. Bartel, MicroRNAs: Target Recognition and Regulatory Functions, Cell, vol.136, pp.215-233, 2009.

J. M. Baskin, J. A. Prescher, S. T. Laughlin, N. J. Agard, P. V. Chang et al., Copper-free click chemistry for dynamic in vivo imaging, Proc. Natl. Acad. Sci, vol.104, pp.16793-16797, 2007.

D. G. Bausch, S. T. Nichol, J. J. Muyembe-tamfum, M. Borchert, P. E. Rollin et al.,

S. Pirard, L. Mardel, H. Olinda, A. Zeller, A. Tshomba et al.,

S. Ksiazek, M. D. Zaki, S. B. Bowen, P. Smit, F. J. Leman et al., Marburg Hemorrhagic Fever Associated with Multiple Genetic Lineages of Virus, N. Engl. J. Med, vol.355, pp.909-919, 2006.

P. M. Beard, S. J. Griffiths, O. Gonzalez, I. R. Haga, T. P. Jowers et al., A loss of function analysis of host factors influencing Vaccinia virus replication by RNA interference, PLoS One, vol.9, 2014.

E. Bekerman and S. Einav, Combating emerging viral threats. Science (80-. ), vol.348, pp.282-283, 2015.

W. G. Bergen and D. B. Bates, Ionophores: their effect on production efficiency and mode of action, J. Anim. Sci, vol.58, pp.1465-1483, 1984.

N. Bharucha, Y. Liu, E. Papanikou, C. Mcmahon, M. Esaki et al., Sec16 influences transitional ER sites by regulating rather than organizing COPII, Mol. Biol. Cell, vol.24, pp.3406-3419, 2013.

D. Bhattacharyya and B. S. Glick, Two Mammalian Sec16 Homologues Have Nonredundant Functions in Endoplasmic Reticulum (ER) Export and Transitional ER Organization, Mol. Biol. Cell, vol.18, pp.839-849, 2007.

X. Bi, R. A. Corpina, and J. Goldberg, Structure of the Sec23/24-Sar1 pre-budding complex of the COPII vesicle coat, Nature, vol.419, pp.271-277, 2002.

F. Boal, L. Guetzoyan, R. B. Sessions, M. Zeghouf, R. A. Spooner et al., LG186: An Inhibitor of GBF1 Function that Causes Golgi Disassembly in Human and Canine Cells, Traffic, vol.11, pp.1537-1551, 2010.

M. Boehm and J. S. Bonifacino, Adaptins: the final recount, Mol. Biol. Cell, vol.12, pp.2907-2920, 2001.

W. Boll, A. Gallusser, and T. Kirchhausen, Role of the regulatory domain of the EGF-receptor cytoplasmic tail in selective binding of the clathrin-associated complex AP-2, Curr. Biol, vol.5, pp.233-241, 1995.

G. Boncompain, S. Divoux, N. Gareil, H. De-forges, A. Lescure et al., Synchronization of secretory protein traffic in populations of cells, Nat. Methods, vol.9, pp.493-498, 2012.

L. Bonfanti, A. A. Mironov, J. A. Martínez-menárguez, O. Martella, A. Fusella et al., Procollagen traverses the Golgi stack without leaving the lumen of cisternae: Evidence for cisternal maturation, Cell, vol.95, pp.993-1003, 1998.

J. S. Bonifacino and B. S. Glick, The Mechanisms of Vesicle Budding and Fusion, Cell, vol.116, pp.153-166, 2004.

J. S. Bonifacino and R. Rojas, Retrograde transport from endosomes to the trans-Golgi network, Nat. Rev. Mol. Cell Biol, vol.7, pp.568-579, 2006.

A. T. Brunger and B. Delabarre, NSF and p97/VCP: Similar at first, different at last, FEBS Lett, vol.555, pp.1107-1111, 2003.

A. Budnik, K. J. Heesom, and D. J. Stephens, Characterization of human Sec16B: indications of specialized, non-redundant functions, Sci. Rep, vol.1, p.77, 2011.

M. V. Bujny, V. Popoff, L. Johannes, and P. J. Cullen, The retromer component sorting nexin-1 is required for efficient retrograde transport of Shiga toxin from early endosome to the trans Golgi network, J. Cell Sci, vol.120, pp.2010-2021, 2007.

C. G. Burd, Physiology and pathology of endosome-to-Golgi retrograde sorting, Traffic, vol.12, pp.948-955, 2011.

P. V. Burgos, G. A. Mardones, A. L. Rojas, L. L. Dasilva, Y. Prabhu et al., Sorting of the A lzheimer's Disease Amyloid Precursor Protein Mediated by the AP-4 Complex, Annu. Rev. Cell Dev. Biol, vol.18, pp.175-205, 2010.

J. L. Campbell and R. Schekman, Selective packaging of cargo molecules into endoplasmic reticulum-derived COPII vesicles (Sar1p ? Sec16p ? secretory proteins ? SNARE proteins), Biochemistry, vol.94, pp.837-842, 1997.

J. Canton and P. E. Kima, Targeting host syntaxin-5 preferentially blocks leishmania parasitophorous vacuole development in infected cells and limits experimental leishmania infections, Am. J. Pathol, vol.181, pp.1348-1355, 2012.

D. W. Carney, C. D. Nelson, B. D. Ferris, J. P. Stevens, A. Lipovsky et al., Structural optimization of a retrograde trafficking inhibitor that protects cells from infections by human polyoma-and papillomaviruses, 2014.

, Bioorganic Med. Chem, vol.22, pp.4836-4847

. Cdc, CDC | Bioterrorism Agents/Diseases | Emergency Preparedness &amp, 2017.

Y. A. Chen and R. H. Scheller, SNARE-mediated membrane fusion, Nat. Rev. Mol. Cell Biol, vol.2, pp.98-106, 2001.

E. Cocucci, F. Aguet, S. Boulant, and T. Kirchhausen, The first five seconds in the life of a clathrin-coated pit, Cell, vol.150, pp.495-507, 2012.

J. F. Collawn, M. Stangel, L. A. Kuhn, V. Esekogwu, S. Jing et al., Transferrin receptor internalization sequence YXRF implicates a tight turn as the structural recognition motif for endocytosis, Cell, vol.63, pp.1061-1072, 1990.

P. L. Connerly, M. Esaki, E. A. Montegna, D. E. Strongin, S. Levi et al., Sec16 is a determinant of transitional ER organization, Curr. Biol, vol.15, pp.1439-1447, 2005.

N. R. Council, Improving the Nation's Water Security: Oportunities for Research, p.170, 2007.

W. Dai, Y. Wu, J. Bi, X. Lu, A. Hou et al., Antiviral effects of Retro-2cycl and Retro-2.1 against Enterovirus 71 in vitro and in vivo, Antiviral Res, vol.144, pp.311-321, 2017.

E. M. Damm, L. Pelkmans, J. Kartenbeck, A. Mezzacasa, T. Kurzchalia et al., Clathrin-and caveolin-1-independent endocytosis: Entry of simian virus 40 into cells devoid of caveolae, J. Cell Biol, vol.168, pp.477-488, 2005.

C. Delevoye, X. Heiligenstein, L. Ripoll, F. Gilles-marsens, M. K. Dennis et al., BLOC-1 Brings Together the Actin and Microtubule Cytoskeletons to Generate Recycling Endosomes, Curr. Biol, vol.26, pp.1-13, 2016.

S. Desmyter, F. Vandenbussche, Q. Hao, P. Proost, W. J. Peumans et al., Type-1 ribosome-inactivating protein from iris bulbs: A useful agronomic tool to engineer virus resistance?, Plant Mol. Biol, vol.51, pp.567-576, 2003.

G. J. Doherty and H. T. Mcmahon, , 2009.

, Annu. Rev. Biochem, vol.78, pp.857-902

J. G. Donaldson, D. Finazzi, and R. D. Klausner, Brefeldin A inhibits Golgi membrane-catalysed exchange of guanine nucleotide onto ARF protein, Nature, vol.360, pp.350-352, 1992.

J. G. Donaldson and A. Honda, Localization and function of Arf family GTPases, Biochem. Soc. Trans, vol.33, pp.639-642, 2005.

J. G. Donaldson, A. Honda, and R. Weigert, Multiple activities for Arf1 at the Golgi complex, Biochim. Biophys. Acta -Mol. Cell Res, vol.1744, pp.364-373, 2005.

S. T. Donta, T. K. Tomicic, and A. Donohue-rolfe, Inhibition of shiga-like toxins by brefeldin a, J. Infect. Dis, vol.171, pp.721-754, 1995.

J. R. Duncan and S. Kornfeld, Intracellular movement of two mannose 6-phosphate receptors: Return to the Golgi apparatus, J. Cell Biol, vol.106, pp.617-628, 1988.

M. Ehrlich, W. Boll, A. Van-oijen, R. Hariharan, K. Chandran et al., Endocytosis by random initiation and stabilization of clathrin-coated pits, Cell, vol.118, pp.591-605, 2004.

Y. Endo, K. Tsurugi, T. Yutsude, Y. Takeda, T. Ogasawara et al., Site of action of a Vero toxin (VT2) from Escherichia coli O157 : H7 and of Shiga toxin on eukaryotic ribosomes, Eur. J. Biochem, vol.171, pp.45-50, 1988.

P. Espenshade, R. E. Gimeno, E. Holzmacher, P. Teung, and C. A. Kaiser, Yeast SEC16 gene encodes a multidomain vesicle coat protein that interacts with Sec23p, J. Cell Biol, vol.131, pp.311-324, 1995.

H. Ewers, W. Römer, A. E. Smith, K. Bacia, S. Dmitrieff et al., GM1 structure determines SV40-induced membrane invagination and infection, vol.12, pp.11-18, 2010.

S. Fath, J. D. Mancias, X. Bi, and J. Goldberg, Structure and Organization of Coat Proteins in the COPII Cage, Cell, vol.129, pp.1325-1336, 2007.

S. Felder, K. Miller, G. Moehren, A. Ullrich, J. Schlessinger et al., Kinase activity controls the sorting of the epidermal growth factor receptor within the multivesicular body, Cell, vol.61, pp.623-634, 1990.

H. Feldmann and T. W. Geisbert, Ebola haemorrhagic fever, Lancet, vol.377, issue.10, pp.60667-60675, 2011.

Y. Feng, A. P. Jadhav, C. Rodighiero, Y. Fujinaga, T. Kirchhausen et al., Retrograde transport of cholera toxin from the plasma membrane to the endoplasmic reticulum requires the trans-Golgi network but not the Golgi apparatus in Exo2-treated cells, EMBO Rep, vol.5, pp.596-601, 2004.

Y. Feng, S. Yu, T. K. Lasell, A. P. Jadhav, E. Macia et al., Ex o1: a new chemical inhibitor of the exocytic pathway, Proc. Natl. Acad. Sci. U. S. A, vol.100, pp.6469-74, 2003.

W. Filipowicz, S. N. Bhattacharyya, and N. Sonenberg, Mechanisms of post-transcriptional regulation by microRNAs: are the answers in sight?, Nat. Rev. Genet, pp.102-114, 2008.

H. Fölsch, M. Pypaert, P. Schu, and I. Mellman, Distribution and function of AP-1 clathrin adaptor complexes in polarized epithelial cells, J. Cell Biol, vol.153, pp.595-606, 2001.

M. G. Ford, Simultaneous Binding of PtdIns(4,5)P2 and Clathrin by AP180 in the Nucleation of Clathrin Lattic es on Membranes. Science (80-. ), vol.291, pp.1051-1055, 2001.

M. E. Fraser, M. M. Chernaia, Y. V. Kozlov, and M. N. James, Crystal structure of the holotoxino from Shigella dysenteriae at 2.5 Å resolution, Nat. Struct. Biol, vol.1, pp.59-64, 1994.

R. Fukuda, J. A. Mcnew, T. Weber, F. Parlati, T. Engel et al., Functional architecture of an intracellular membrane t-SNARE, Nature, vol.407, pp.198-202, 2000.

J. Furst, R. B. Sutton, J. Chen, A. T. Brunger, and N. Grigorieff, Electron cryomicroscopy structure of N -ethyl maleimide sensitive factor at 11 Å resolution, EMBO J, vol.22, pp.4365-4374, 2003.

C. E. Futter, A. Pearse, L. J. Hewlett, and C. R. Hopkins, Multivesicular endosomes containing internalized EGF-EGF receptor complexes mature and then fuse directly with lysosomes, J. Cell Biol, vol.132, pp.1011-1023, 1996.

T. Gallusser and . Kirchhausen, The beta 1 and beta 2 subunits of the AP complexes are the clathrin coat assembly components, EMBO J, vol.12, pp.5237-5281, 1993.

I. G. Ganley, E. Espinosa, and S. R. Pfeffer, A syntaxin 10-SNARE complex distinguishes two distinct transport routes from endosomes to the trans-Golgi in human cells, J. Cell Biol, vol.180, pp.159-172, 2008.

O. Garred, B. Van-deurs, and K. Sandvig, Furin-induced cleavage and activation of shiga toxin, J. Biol. Chem, vol.270, pp.10817-10821, 1995.

C. F. De-gascun and M. J. Carr, Human polyomavirus reactivation: Disease pathogenesis and treatment approaches, Clin. Dev. Immunol, 2013.

D. Gillet, J. Barbier, M. R. Popoff, D. Gillet, and J. Barbier, Diphtheria toxin, The Comprehensive Sourcebook of Bacterial Protein Toxins, pp.111-132, 2015.
URL : https://hal.archives-ouvertes.fr/hal-01186603

A. K. Gillingham and S. Munro, Long coiled-coil proteins and membrane traffic, Biochim. Biophys. Acta -Mol. Cell Res, vol.1641, pp.71-85, 2003.

R. E. Gimeno, P. Espenshade, and C. Kaiser, COPII Coat Subunit Interactions: Sec24p and Sec23p Bind to Adjacent Regions of Secl6p, 1996.

, Mol Biol Cell, vol.7, pp.1815-1823

N. K. Gonatas, A. Steiber, S. U. Kim, D. I. Graham, and S. Avrameas, Internalization of neuronal plasma membrane ricin receptors into the Golgi apparatus, Exp. Cell Res, vol.94, pp.426-431, 1975.

A. R. Gonzales, R. B. Schofield, and G. R. Schmitt, Policy Agroterrorism -Why We ' re Not Ready : A Look at the Role of Law Enforcement, 2006.

F. Gottron and D. A. Shea, Federal Efforts to Address the Threat of Bioterrorism : Selected Issues for Congress, 2010.

B. D. Grant and J. G. Donaldson, Pathways and mechanisms of endocytic recycling, Nat. Rev. Mol. Cell Biol, vol.10, pp.597-608, 2009.

A. Grassart, A. Dujeancourt, P. B. Lazarow, A. Dautry-varsat, and N. Sauvonnet, Clathrin-independent endocytosis used by the IL-2 receptor is regulated by Rac1, Pak1 and Pak2, EMBO Rep, vol.9, pp.356-62, 2008.
URL : https://hal.archives-ouvertes.fr/pasteur-00332556

J. Grove and M. Marsh, The cell biology of receptor-mediated virus entry, J. Cell Biol, vol.195, pp.1071-1082, 2011.

J. Gruenberg and H. Stenmark, The biogenesis of multivesicular endosomes, Nat. Rev. Mol. Cell Biol, vol.5, pp.317-323, 2004.

L. J. Guetzoyan, R. A. Spooner, F. Boal, D. J. Stephens, J. M. Lord et al., Fine tuning Exo2, a small molecule inhibitor of secretion and retrograde trafficking pathways in mammalian cells, Mol. Biosyst, vol.6, p.2030, 2010.

L. J. Guetzoyan, R. A. Spooner, J. M. Lord, L. M. Roberts, and G. J. Clarkson, Simple oxidation of pyrimidinylhydrazones t o triazolopyrimidines and their inhibition of Shiga toxin trafficking, Eur. J. Med. Chem, vol.45, pp.275-283, 2010.

N. Gupta, R. No??l, A. Goudet, K. Hinsinger, A. Michau et al.,

J. Rudel, P. M. Vacus, R. A. Loiseau, E. Davey, J. C. Oswald et al., Inhibitors of retrograde trafficking active against ricin and Shiga toxins also protect cells from several viruses, Leishmania and Chlamydiales, Chem. Biol. Interact, vol.267, pp.96-103, 2017.

N. Gupta, V. Pons, R. Noël, D. A. Buisson, A. Michau et al., (S)-N-methyldihydroquinazolinones are the active enantiomers of retro-2 derived compounds against toxins, ACS Med. Chem. Lett, vol.5, pp.94-97, 2014.

H. T. Haigler, J. A. Mckanna, and S. Cohen, Direct visualization of the binding and internalization of a ferritin conjugate of epidermal growth factor in human carcinoma cells A-431, J. Cell Biol, vol.81, pp.382-395, 1979.

C. Harding, J. Heuser, and P. Stahl, Receptor-mediated endocytosis of transferrin and recycling of the transferrin receptor in rat reticulocytes, J. Cell Biol, vol.97, pp.329-339, 1983.

C. B. Harper, M. R. Popoff, A. Mccluskey, P. J. Robinson, and F. A. Meunier, Targeting membrane trafficking in infection p rophylaxis: Dynamin inhibitors, Trends Cell Biol, vol.23, pp.90-101, 2013.

K. Harrison, I. R. Haga, T. Jowers, S. Jasim, J. Cintrat et al., Vaccinia Virus Uses Retromer-Independent Cellular Retrograde Transport Pathways To Facilitate the Wrapping of Intracellular Mature Virions during Virus Morphogenesis, J. Virol, vol.90, pp.10120-10132, 2016.

J. C. Hay, J. Klumperman, V. Oorschot, M. Steegmaier, C. S. Kuo et al., Localization, dynamics, and protein interactions reveal distinct roles for ER and Golgi SNAREs, J. Cell Biol, vol.141, pp.1489-1502, 1998.

W. M. Henne, E. Boucrot, M. Meinecke, E. Evergren, Y. Vallis et al., FCHo Proteins Are Nucleators of Clathrin-Mediated Endocytosis. Science (80-. ), vol.328, pp.1281-1284, 2010.

J. A. Herweg, V. Pons, D. Becher, M. Hecker, G. Krohne et al., Proteomic analysis of the Simkaniacontaining vacuole: The central role of retrograde transport, Mol. Microbiol, vol.99, pp.151-171, 2016.

A. Hierro, A. L. Rojas, R. Rojas, N. Murthy, G. Effantin et al., Functional architecture of the retromer cargo-recognition complex, Nature, vol.449, pp.1063-1067, 2007.

J. Hirst, S. E. Miller, M. J. Taylor, G. F. Von-mollard, and M. S. Robinson, EpsinR Is an Adaptor for the SNARE Protein Vti1b, Mol. Biol. Cell, vol.15, pp.5593-5602, 2004.

J. Hirst, A. Motley, K. Harasaki, S. Y. Chew, and M. S. Robinson, EpsinR: an ENTH Domain-containing Protein that Interacts with AP-1, 2003.

, Mol. Biol. Cell, vol.14, pp.2559-2569

T. M. Hohl, F. Parlati, C. Wimmer, J. E. Rothman, T. H. Söllner et al., Arrangement of subunits in 20 S particles consisting of NSF, SNAPs, and SNARE complexes, Mol. Cell, vol.2, pp.539-548, 1998.

W. Hong, SNAREs and traffic, Biochim. Biophys. Acta -Mol. Cell Res, vol.1744, pp.120-144, 2005.

C. Hu, Fusion of Cells by Flipped SNAREs. Science (80-. ), vol.300, pp.1745-1749, 2003.

M. Huang, J. T. Weissman, S. Béraud-dufour, P. Luan, C. Wang et al., Crystal structure of Sar1-GDP at 1.7 Å resolution and the role of the NH2 terminus in ER export, J. Cell Biol, vol.155, pp.937-948, 2001.
URL : https://hal.archives-ouvertes.fr/hal-02266872

R. Hueisgen, Proceedings of the Chemical Society, vol.357, 1961.

H. Hughes, A. Budnik, K. Schmidt, K. J. Palmer, J. Mantell et al., Organisation of human ER-exit sites: requirements for the localisation of Sec16 to transitional ER, J. Cell Sci, vol.122, pp.2924-2934, 2009.

N. Hui, N. Nakamura, B. Sönnichsen, D. T. Shima, T. Nilsson et al., An isoform of the Golgi t-SNARE, syntaxin 5, with an endoplasmic reticulum retrieval signal, Mol. Biol. Cell, vol.8, pp.1777-87, 1997.

V. Ivan, G. De, D. Voer, K. M. Xanthakis, V. Spoorendonk et al., Drosophila Sec16 Mediates the Biogenesis of tER Sites Upstream of Sar1 through an Arginine-Rich Motif, Mol. Biol. Cell, vol.19, pp.4352-4365, 2008.

M. Jacewicz, H. Clausen, E. Nudelman, G. T. Donohue-rolfe, and . Keusch, Pathogenesis of shigella diarrhea. XI. Isolation of a shigella toxin-binding glycolipid from rabbit jejunum and HeLa cells and its identification as globotriaosylceramide, J. Exp. Med, vol.163, pp.1391-1404, 1986.

C. L. Jackson, Mechanisms of transport through the Golgi complex, J. Cell Sci, vol.122, pp.443-452, 2009.

R. Jahn, T. Lang, and T. C. Südhof, Membrane fusion, Cell, vol.112, pp.519-533, 2003.

L. Johannes and B. Goud, Surfing on a retrograde wave: How does Shiga toxin reach the endoplasmic reticulum?, Trends Cell Biol, vol.8, pp.158-162, 1998.

L. Johannes, R. G. Parton, P. Bassereau, and S. Mayor, Building endocytic pits without clathrin, Nat. Rev. Mol. Cell Biol, vol.16, pp.311-321, 2015.

L. Johannes and V. Popoff, Tracing the Retrograde Route in Protein Trafficking, Cell, vol.135, pp.1175-1187, 2008.

L. Johannes and W. Römer, Shiga toxins -from cell biology to biomedical applications, Nat. Rev. Microbiol, vol.8, pp.105-121, 2010.

L. Johannes and C. Wunder, The SNXy flavours of endosomal sorting, Nat. Cell Biol, vol.13, pp.884-886, 2011.

L. Johannes and C. Wunder, Retrograde transport: Two (or more) roads diverged in an endosomal tree, Traffic, vol.12, pp.956-962, 2011.

L. Johannes, C. Wunder, and M. Shafaq-zadah, Glycolipids and Lectins in Endocytic Uptake Processes, J. Mol. Biol, vol.428, pp.4792-4818, 2016.

K. E. Jones, N. G. Patel, M. A. Levy, A. Storeygard, D. Balk et al., Global trends in emerging in fectious diseases. Kirchhausen, T. 2000. Clathrin, 2008.

T. Kirchhausen and S. C. Harrison, Protein organization in clathrin trimers, Cell, vol.23, pp.90439-90445, 1981.

T. Kirchhausen, D. Owen, and S. C. Harrison, Molecular structure, function, and dynamics of clathrin-mediated membrane traffic, Cold Spring Harb. Perspect. Biol, vol.6, 2014.

R. D. Klausner, J. G. Donaldson, and J. Lippincott-schwartz, Brefeldin A: Insights into the control of membrane traffic and organelle structure, J. Cell Biol, vol.116, pp.1071-1080, 1992.

M. Kleijmeer, G. Ramm, D. Schuurhuis, J. Griffith, M. Rescigno et al.,

H. J. Stoorvogel and . Geuze, Reorganization of multivesicular bodies regulates MHC class II 11 antigen presentation by dendritic cells, J. Cell Biol, vol.155, pp.53-63, 2001.

J. Konowalchuk, J. I. Speirs, and S. Stavric, Vero response to a cytotoxin of Escherichia coli, Infect. Immun, vol.18, pp.775-779, 1977.

I. Kouranti, M. Sachse, N. Arouche, B. Goud, and A. Echard, Rab35 Regulates an Endocytic Recycling Pathway Essential f or the Terminal Steps of Cytokinesis, Curr. Biol, vol.16, pp.1719-1725, 2006.

L. F. Kung, S. Pagant, E. Futai, J. G. D'arcangelo, R. Buchanan et al., Sec24p and Sec16p cooperate to regulate the GTP cycle of the COPII coat, EMBO J, vol.31, pp.1014-1027, 2012.

R. Lakshminarayan, C. Wunder, U. Becken, M. T. Howes, C. Benzing et al., Galectin-3 drives glycosphingolipid-dependent biogenesis of clathrinindependent carriers, Nat. Cell Biol, vol.16, pp.595-606, 2014.

C. Lamaze, A. Dujeancourt, T. Baba, C. G. Lo, A. Benmerah et al., Interleukin 2 receptors and detergent-resistant membrane domains define a clathrin-independent endocytic pathway, Mol. Cell, vol.7, pp.661-671, 2001.

S. U. Lauvrak, Efficient endosome-to-Golgi transport of Shiga toxin is dependent on dynamin and clathrin, J. Cell Sci, vol.117, pp.2321-2331, 2004.

P. W. Ledger, N. Uchida, and M. L. Tanzer, Immunocytochemical localization of procollagen and fibronectin in human fibroblasts: Effects of the monovalent lonophore, monensin, J. Cell Biol, vol.87, pp.663-671, 1980.

M. C. Lee, E. A. Miller, J. Goldberg, L. Orci, and R. Schekman, Bi-Directional Protein Transport Between the Er and Golgi, Annu. Rev. Cell Dev. Biol, vol.20, pp.87-123, 2004.

L. Li, J. Jose, Y. Xiang, R. J. Kuhn, and M. G. Rossmann, Structural changes of envelope proteins during alphavirus fusion, Nature, vol.468, pp.705-708, 2010.

Z. Z. Lieu and P. A. Gleeson, Identification of different itineraries and retromer components for endosome-to-Golgi transport of TGN38 and Shiga toxin, Eur. J. Cell Biol, vol.89, pp.379-393, 2010.

A. Lindberg, J. E. Brown, N. Strömberg, M. Westling-ryd, J. E. Schultz et al., Identification of the carbohydrate receptor for Shiga toxin produced by Shigella dysenteriae type 1, J. Biol. Chem, vol.262, pp.1779-85, 1987.

H. Ling, A. Boodhoo, B. Hazes, M. D. Cummings, G. D. Armstrong et al., Structure of the Shiga -like toxin I Bpentamer complexed with an analogue of its receptor Gb3, Biochemistry, vol.37, pp.1777-1788, 1998.

A. D. Linstedt, A. Mehta, J. Suhan, H. Reggio, and H. Hauri, Sequence and Overexpression of GPP130/GIMPc: Evidence for Saturable pH-sensitive Targeting of a Type II Early Golgi Membrane Protein, Mol. Biol. Cell, vol.8, pp.1073-1087, 1997.

D. Lombardi, T. Soldati, M. A. Riederer, Y. Goda, M. Zerial et al., Rab9 functions in transport between late endosomes and the trans Golgi network, EMBO J, vol.12, pp.677-82, 1993.

P. H. Lu, S. C. Chueh, F. L. Kung, S. L. Pan, Y. C. Shen et al., Ilimaquinone, a marine sponge metabolite, displays anticancer activity via GADD153-mediated pathway, Eur. J. Pharmacol, vol.556, pp.45-54, 2007.

J. P. Luzio, B. Brake, G. Banting, K. E. Howell, P. Braghetta et al., Identification, sequencing and expression of an integral membrane protein of the trans-Golgi network (TGN38), Biochem. J, vol.270, pp.97-102, 1990.

T. T. Mai, A. Hamaï, A. Hienzsch, T. Cañeque, S. Müller et al., Salinomycin kills cancer stem cells by sequestering iron in lysosomes, Nat. Chem. 1-9, 2017.
URL : https://hal.archives-ouvertes.fr/hal-01787681

L. Maldonado-báez, C. Williamson, and J. G. Donaldson, Clathrin-independent endocytosis: A cargo-centric view, Exp. Cell Res, vol.319, pp.2759-2769, 2013.

F. Mallard, C. Antony, D. Tenza, J. Salamero, B. Goud et al., Direct pathway from early/recycling endosomes to the Golgi apparatus revealed through the study of Shiga toxin B-fragment transport, J. Cell Biol, vol.143, pp.973-990, 1998.

F. Mallard and L. Johannes, Shiga toxin B-subunit as a tool to study retrograde transport, Methods Mol Med, vol.73, pp.209-229, 2003.

F. Mallard, B. L. Tang, T. Galli, D. Tenza, A. Saint-pol et al., Early/recycling endosomesto-TGN transport involves two SNARE complexes and a Rab6 isoform, J. Cell Biol, vol.156, pp.653-664, 2002.

J. D. Mancias and J. Goldberg, Structural basis of cargo membrane protein discrimination by the human COPII coat machinery, EMBO J, vol.27, pp.2918-2928, 2008.

P. Mansueto, A. Seidita, G. Vitale, and A. Cascio, Leishmaniasis in travelers: A literature review, Travel Med. Infect. Dis, vol.12, pp.563-581, 2014.

K. Matsuoka, L. Orci, M. Amherdt, S. Y. Bednarek, S. Hamamoto et al., COPII-coated vesicle formation reconstituted with purified coat proteins and chemically defined liposomes, Cell, vol.93, pp.81577-81586, 1998.

R. Mattera, C. M. Guardia, S. S. Sidhu, and J. S. Bonifacino, Bivalent motif-ear interactions mediate the association of the accessory protein tepsin with the AP-4 adaptor complex, J. Biol. Chem, vol.290, pp.30736-30749, 2015.

S. Mayor and R. E. Pagano, Pathways of clathrin-independent endocytosis, Nat. Rev. Mol. Cell Biol, vol.8, pp.603-612, 2007.

S. Mayor, R. G. Parton, and J. G. Donaldson, Clathrin-independent pathways of endocytosis, Cold Spring Harb. Perspect. Biol, vol.6, 2014.

K. Mcgourty, T. L. Thurston, S. A. Matthews, L. Pinaud, L. J. Mota et al., Salmonella inhibits retrograde trafficking of mannose-6-phosphate receptors and lysosome function, Science, vol.338, pp.963-970, 2012.

C. Mcmahon, S. M. Studer, C. Clendinen, G. P. Dann, P. D. Jeffrey et al., The structure of Sec12 implicates potassium ion coordination in Sar1 activation, J. Biol. Chem, vol.287, pp.43599-43606, 2012.

H. T. Mcmahon and E. Boucrot, Molecular mechanism and physiological functions of clathrin-mediated endocytosis, Nat. Rev. Mol. Cell Biol, vol.12, pp.517-533, 2011.

J. A. Mcnew, F. Parlati, R. Fukuda, R. J. Johnston, K. Paz et al., Compartmental specificity of cellular membrane fusion encoded in SNARE proteins, Nature, vol.407, pp.153-159, 2000.

C. Meyer, D. Zizioli, S. Lausmann, E. L. Eskelinen, J. Hamann et al., mu1A-adaptin-deficient mice: lethality, loss of AP-1 binding and rerouting of mannose 6-phosphate receptors, EMBO J, vol.19, pp.2193-2203, 2000.

S. Miles, H. Mcmanus, K. E. Forsten, and B. Storrie, Evidence that the entire Golgi apparatus cycles in interphase HeLa cells: Sensitivity of Golgi matrix proteins to an ER exit block, J. Cell Biol, vol.155, pp.543-555, 2001.

E. A. Miller and C. Barlowe, Regulation of coat assembly-sorting things out at the ER, Curr. Opin. Cell Biol, vol.22, pp.447-453, 2010.

E. A. Miller, T. H. Beilharz, P. N. Malkus, M. C. Lee, S. Hamamoto et al., Multiple cargo binding sites on the COPII subunit Sec24p ensure capture of diverse membrane proteins into transport vesicles, Cell, vol.114, issue.03, pp.609-612, 2003.

E. A. Miller and R. Schekman, COPII -a flexible vesicle formation system, Curr. Opin. Cell Biol, vol.25, pp.420-427, 2013.

I. G. Mills, G. J. Praefcke, Y. Vallis, B. J. Peter, L. E. Olesen et al., Epsinr: An AP1/clathrin interacting protein involved in vesicle trafficking, J. Cell Biol, vol.160, pp.213-222, 2003.

K. Miyazaki, Y. Wakana, C. Noda, K. Arasaki, A. Furuno et al., Contribution of the long form of syntaxin 5 to the organization of the endoplasmic reticulum, J. Cell Sci, vol.125, pp.5658-5666, 2012.

H. H. Mollenhauer, D. J. Morré, and L. D. Rowe, Alteration of intracellular traffic by monensin; mechanism, specificity and relationship to toxicity, BBA -Rev. Biomembr, vol.1031, pp.225-246, 1990.

S. S. Molloy, P. A. Bresnahan, S. H. Leppla, K. R. Klimpel, and G. Thomas, Human furin is a calcium-dependent serine endoprotease that recognizes the sequence Arg-X-X-Arg and efficiently cleaves anthrax toxin protective antigen, J. Biol. Chem, vol.267, pp.16396-16402, 1992.

G. Montagnac, H. De-forges, E. Smythe, C. Gueudry, M. Romao et al., Decoupling of activation and effector binding underlies ARF6 priming of fast endocytic recycling, Curr. Biol, vol.21, pp.574-579, 2011.

R. Montesano, J. Roth, A. Robert, and L. Orci, Non-coated membrane invaginations are involved in binding and internalization of cholera and tetanus toxins, Nature, vol.296, pp.651-653, 1982.

D. M. Morens, G. K. Folkers, and A. S. Fauci, The challenge of emerging and re-emerging infectious diseases, Nature, vol.430, pp.242-249, 2004.

E. Mossessova, L. C. Bickford, and J. Goldberg, SNARE selectivity of the COPII coat, Cell, vol.114, pp.608-609, 2003.

E. Mossessova, R. A. Corpina, and J. Goldberg, Crystal Structure of ARF1?Sec7 Complexed with Brefeldin A and Its Implications for the Guanine Nucleotide Exchange Mechanism, Mol. Cell, vol.12, pp.1403-1411, 2003.

M. Moya, A. Dautry-varsat, B. Goud, D. Louvard, and P. Boquet, Inhibition of Coated Pit Formation in Hep2 Cells Blocks the Cytotoxicity of Diphtheria Toxin But Not That of Ricin Toxin, J. Cell Biol, 1985.

S. Mukhopadhyay, C. Bachert, D. R. Smith, and A. D. Linstedt, Manganese-induced Trafficking and Turnover of the cis -Golgi Glycoprotein GPP130, Mol. Biol. Cell, vol.21, pp.1282-1292, 2010.

S. Mukhopadhyay and A. D. Linstedt, Manganese Blocks Intracellular Trafficking of Shiga Toxin and Protects Against Shiga Toxicosis. Science (80-. ), vol.335, pp.332-335, 2012.

S. Mukhopadhyay, B. Redler, and A. D. Linstedt, Shiga toxin-binding site for host cell receptor GPP130 reveals unexpected divergence in toxin-trafficking mechanisms, Mol. Biol. Cell, vol.24, pp.2311-2318, 2013.

J. L. Murk, W. Stoorvogel, M. J. Kleijmeer, and H. J. Geuze, The plasticity of multivesicular bodies and the regulation of antigen presentation, Semin. Cell Dev. Biol, vol.13, pp.303-311, 2002.

M. Nambiar, Ilimaquinone Inhibits the Cytotoxicities of Ricin, Diphtheria Toxin, and Other Protein Toxins in Vero Cells, Exp. Cell Res, vol.219, pp.671-678, 1995.

P. Nassoy and C. Lamaze, Stressing caveolae new role in cell mechanics, Trends Cell Biol, vol.22, pp.381-389, 2012.
URL : https://hal.archives-ouvertes.fr/hal-00821324

R. Natarajan and A. D. Linstedt, A cycling cis-Golgi protein mediates endosome-to-Golgi traffic, Mol. Biol. Cell, vol.15, pp.4798-806, 2004.

, NIAID Emerging Infectious Diseases/Pathogens | NIH: National Institute of Allergy and Infectious Diseases, 2017.

C. D. Nelson, D. W. Carney, A. Derdowski, A. Lipovsky, G. V. Gee et al., A retrograde trafficking inhibitor of ricin and Shiga-like toxins inhibits infection of cells by human and monkey polyomaviruses, 2013.

N. Neumann, D. Lundin, and A. M. Poole, Comparative genomic evidence for a complete nuclear pore complex in the last eukaryotic common ancestor, PLoS One, vol.5, 2010.

B. J. Nichols, A. K. Kenworthy, R. S. Polishchuk, R. Lodge, T. H. Roberts et al., Rapid cycling of lipid raft markers between the cell surface and golgi complex, J. Cell Biol, vol.152, pp.529-541, 2001.

B. J. Nichols and H. R. Pelham, SNAREs and membrane fusion in the Golgi apparatus, Biochim. Biophys. Acta -Mol. Cell Res, vol.1404, pp.9-31, 1998.

K. Nielsen and R. S. Boston, RIBOSOME-INACTIVATING PROTEINS: A Plant Perspective, Annu. Rev. Plant Physiol. Plant Mol. Biol, vol.52, pp.785-816, 2001.

X. Ning, J. Guo, M. A. Wolfert, and G. J. Boons, Visualizing metabolically labeled glycoconjugates of living cells by copper-free and fast huisgen cycloadditions, Angew. Chemie -Int. Ed, vol.47, pp.2253-2255, 2008.

J. H. No, Visceral leishmaniasis: Revisiting current treatments and approaches for future discoveries, Acta Trop, vol.155, pp.113-123, 2016.

R. Noel, N. Gupta, V. Pons, A. Goudet, M. D. Garcia-castillo et al., N -Methyldihydroquinazolinone derivatives of retro-2 with enhanced efficacy against shiga toxin, J. Med. Chem, vol.56, pp.3404-3413, 2013.

M. E. Nonnenmacher, J. Cintrat, D. Gillet, and T. Weber, Syntaxin 5-Dependent Retrograde Transport to the trans -Golgi Network Is Required for Adeno-Associated Virus Transduction, J. Virol, vol.89, pp.1673-1687, 2015.

P. Novick, C. Field, and R. Schekman, Identification of 23 complementation groups required for post-translational events in the yeast secretory pathway, Cell, vol.21, pp.205-215, 1980.

S. Nr, T. Force, N. Angaben, E. Sa, D. Bfr et al., Samen von Bockshornklee mit hoher Wahrscheinlichkeit für EHEC O104 : H4 Ausbruch verantwortlich, pp.22-24, 2011.

J. C. Nutr and H. Sandstead, Sandstead HH : Requirements and toxicity of essential trace elements, vol.61, pp.5-9, 2016.

A. D. O'brien, J. W. Newland, S. F. Miller, R. K. Holmes, H. W. Smith et al., Shiga-like toxin-converting phages from Escherichia coli strains that cause hemorrhagic colitis or infantile diarrhea, Science, vol.226, pp.694-700, 1984.

L. Oestereich, A. Lüdtke, S. Wurr, T. Rieger, C. Muñoz-fontela et al., Successful treatment of advanced Ebola virus infection with T-705 (favipiravir) in a small animal model, Antiviral Res, vol.105, pp.17-21, 2014.

L. Orci, M. Stamnes, M. Ravazzola, M. Amherdt, A. Perrelet et al., Bidirectional transport by distinct populations of COPI-coated vesicles, Cell, vol.90, pp.335-349, 1997.

D. J. Owen, Linking endocytic cargo to clathrin: structural and functional insights into coated vesicle formation, Biochem. Soc. Trans, vol.32, pp.1-14, 2004.

G. Palade, Intracellular Aspects of the Process of Protein Synthesis. Science (80-. ), vol.189, pp.867-867, 1975.

J. G. Park, J. N. Kahn, N. E. Tumer, and Y. Pang, Chemical Structure of Retro-2, a Compound That Protects Cells against Ribosome-Inactivating Proteins, Sci. Rep, vol.2, p.631, 2012.

R. G. Parton and M. A. Del-pozo, Caveolae as plasma membrane sensors, protectors and organizers, Nat. Rev. Mol. Cell Biol, vol.14, pp.98-112, 2013.

G. H. Patterson, K. Hirschberg, R. S. Polishchuk, D. Gerlich, R. D. Phair et al., Transport through the Golgi Apparatus by Rapid Partitioning within a Two-Phase Membrane System, Cell, vol.133, pp.1055-1067, 2008.

B. M. Pearse, Clathrin: A unique protein associated with intracellualar transfer of membrane by coated vesicles, Proc Natl Acad Sci U S A, vol.73, pp.1255-1259, 1976.

L. Pelkmans, J. Kartenbeck, and . Helenius, Caveolar endocytosis of simian virus 40 reveals a new two-step vesicular-transport pathway to the ER, Nat. Cell Biol, vol.3, pp.473-483, 2001.

F. J. Perez-victoria and J. S. Bonifacino, Dual Roles of the Mammalian GARP Complex in Tethering and SNARE Complex Assembly at the trans-Golgi Network, Mol. Cell. Biol, vol.29, pp.5251-5263, 2009.

B. J. Peter, BAR Domains as Sensors of Membrane Curvature: The Amphiphysin BAR Structure. Science (80-. ), vol.303, pp.495-499, 2004.

W. J. Peumans, Q. Hao, and E. L. Van-damme, Ribosome-inactivating proteins from plants: more than RNA N-glycosidases?, FASEB J, vol.15, pp.1493-1506, 2001.

A. Peyroche, B. Antonny, S. Robineau, J. Acker, J. Cherfils et al., Brefeldin A acts to stabilize an abortive ARF-GDP-Sec7 domain protein complex: Involvement of specific residues of the Sec7 domain, Mol. Cell, vol.3, pp.80455-80459, 1999.

W. Pezeshkian, A. G. Hansen, L. Johannes, H. Khandelia, J. C. Shillcock et al., Membrane invagination induced by Shiga toxin B-subunit: from molecular structure to tube formation, Soft Matter, vol.12, pp.5164-5171, 2016.

R. C. Piper and D. J. Katzmann, Biogenesis and Function of Multivesicular Bodies, Annu. Rev. Cell Dev. Biol, vol.23, pp.519-547, 2007.

V. Popoff, G. A. Mardones, S. K. Bai, V. Chambon, D. Tenza et al.,

J. , Analysis of articulation between clathrin and retromer in retrograde sorting on early endosomes, Traffic, vol.10, pp.1868-1880, 2009.

V. Popoff, G. A. Mardones, D. Tenza, R. Rojas, C. Lamaze et al., The retromer complex and clathrin define an early endosomal retrograde exit site, J. Cell Sci, vol.120, pp.2022-2031, 2007.

S. Puri, C. Bachert, C. J. Fimmel, and A. D. Linstedt, Cycling of Early Golgi Proteins Via the Cell Surface and Endosomes Upon Lumenal pH Disruption, Traffic, vol.3, pp.641-653, 2002.

H. S. Radeke, C. A. Digits, R. L. Casaubon, and M. L. Snapper, Interactions of (-)-ilimaquinone with methylation enzymes: Implications for vesicular-mediated secretion, Chem. Biol, vol.6, pp.639-647, 1999.

K. J. Rayner, Y. Suarez, A. Davalos, S. Parathath, M. L. Fitzgerald et al., MiR-33 Contributes to the Regulation of Cholesterol Homeostasis, Science, vol.328, pp.1570-1573, 2010.

B. Reaves, M. Horn, and G. Banting, TGN38/41 recycles between the cell surface and the TGN: brefeldin A affects its rate of return to the TGN, Mol Biol Cell, vol.4, pp.93-105, 1993.

B. Reaves, G. Wilde, and . Banting, Identification, molecular characterization and immunolocalization of an isoform of the trans-Golginetwork (TGN)-specific integral membrane protein TGN38, Biochem. J, vol.283, pp.313-316, 1992.

U. Rein, U. Andag, R. Duden, H. D. Schmitt, and A. Spang, ARF-GAP-mediated interaction between the ER-Golgi v-SNAREs and the COPI coat, J. Cell Biol, vol.157, pp.395-404, 2002.

S. Reinbothe, C. Reinbothe, J. Lehmann, W. Becker, K. Apel et al., JIP60, a methyl jasmonate -induced ribosome-inactivating protein involved in plant stress reactions, Proc. Natl. Acad. Sci. U. S. A, vol.91, pp.7012-7018, 1994.

M. S. Robinson, Adaptable adaptors for coated vesicles, Trends Cell Biol, vol.14, pp.167-174, 2004.

A. Rodriguez, S. Griffiths-jones, J. L. Ashurst, and A. Bradley, Identification of mammalian microRNA host genes and transcription units, 2004.

, Genome Res, vol.14, pp.1902-1910

R. Rodriguez and K. M. Miller, Unravelling the genomic targets of small molecules using high-throughput sequencing, Nat. Rev. Genet, vol.15, pp.783-796, 2014.
URL : https://hal.archives-ouvertes.fr/hal-01110554

R. Rojas, T. Van-vlijmen, G. A. Mardones, Y. Prabhu, A. L. Rojas et al., Regulation of retromer recruitment to endosomes by sequential action of Rab5 and Rab7, J. Cell Biol, vol.183, pp.513-526, 2008.

W. Römer, L. Berland, V. Chambon, K. Gaus, B. Windschiegl et al., Shiga toxin induces tubular membrane invaginations for its uptake into cells, Nature, vol.450, pp.670-675, 2007.

W. Römer, L. L. Pontani, B. Sorre, C. Rentero, L. Berland et al., Actin Dynamics Drive Membrane Reorganization and Scission in Clathrin-Independent Endocytosis, Cell, vol.140, pp.540-553, 2010.

E. Van-rooij, D. Quiat, B. A. Johnson, L. B. Sutherland, X. Qi et al., A Family of microRNAs Encoded by Myosin Genes Governs Myosin Expression and Muscle Performance, Dev. Cell, vol.17, pp.662-673, 2009.

V. V. Rostovtsev, L. G. Green, V. V. Fokin, and K. B. Sharpless, A stepwise huisgen cycloaddition process: C opper(I)-catalyzed regioselective "ligation" of azides and terminal alkynes, Angew. Chemie -Int. Ed, vol.41, pp.2596-2599, 2002.

T. Roth and K. Porter, Yolk Protein Uptake in the Oocyte of the Mosquito Aedes Aegypti, L. J. Cell Biol, vol.20, pp.313-332, 1964.

G. E. Rydell, L. Svensson, G. Larson, L. Johannes, and W. Römer, Human GII.4 norovirus VLP induces membrane invaginations on giant unilamellar vesicles containing secretor gene dependent ?1,2-fucosylated glycosphingolipids, Biochim. Biophys. Acta -Biomembr, vol.1828, pp.1840-1845, 2013.

J. B. Saenz, T. A. Doggett, and D. B. Haslam, Identification and characterization of small molecules that inhibit intracellular toxin transport, Infect. Immun, vol.75, pp.4552-4561, 2007.

J. B. Sáenz, W. J. Sun, J. W. Chang, J. Li, B. Bursulaya et al., Golgicide A reveals essential roles for GBF1 in Golgi assembly and function, Nat. Chem. Biol, vol.5, pp.157-165, 2009.

H. K. Saini, S. Griffiths-jones, and A. J. Enright, Genomic analysis of human microRNA transcripts, Proc. Natl. Acad. Sci. U. S. A, vol.104, pp.17719-17743, 2007.

A. Saint-pol, B. Yélamos, M. Amessou, I. G. Mills, M. Dugast et al., Clathrin adaptor epsinR is required for retrograde sorting on early endosomal membranes, Dev. Cell, vol.6, pp.100-105, 2004.

K. Sandvig, Shiga toxins, Toxicon, vol.39, pp.1629-1635, 2001.

K. Sandvig and B. Van-deurs, Entry of ricin and Shiga toxin into cells: molecular mechanisms and medical perspectives, Embo J, vol.19, pp.5943-5950, 2000.

K. Sandvig, O. Garred, K. Prydz, J. Kozlov, S. H. Hansen et al., Retrograde transport of endocytosed Shiga toxin to the endoplasmic reticulum, Nature, vol.358, pp.510-512, 1992.

K. Sandvig, S. Olsnes, J. E. Brown, O. W. Petersen, and B. Van-deurs, Endocytosis from coated pits of Shiga toxin: A glycolipid-binding protein from Shigella dysenteriae 1, J. Cell Biol, vol.108, pp.1331-1343, 1989.

S. K. Saxena, A. D. O'brien, and E. J. Ackerman, Shiga toxin, Shiga-like toxin II variant, and ricin are all single-site RNA N-glycosidases of 28 S RNA when microinjected into Xenopus oocytes, J. Biol. Chem, vol.264, pp.596-601, 1989.

H. M. Van-der-schaar, M. J. Rust, H. Chen, J. Van-der-ende-metselaar, X. Wilschut et al., Dissecting the cell entry pathway of dengue virus by single-particle tracking in living cells, PLoS Pathog, vol.4, 2008.

C. Schindler, Y. Chen, J. Pu, X. Guo, and J. S. Bonifacino, EARP is a multisubunit tethering complex involved in endocytic recycling, Nat. Cell Biol, vol.17, pp.639-650, 2015.

D. M. Schlossman, S. L. Schmid, W. A. Braell, and J. E. Rothman, An enzyme that removes clathrin coats: Purification of an uncoating ATPase, J. Cell Biol, vol.99, pp.723-733, 1984.

A. Sciences, G. Nikoleli, S. Karapetis, S. Bratakou, D. P. Nikolelis et al., Biosensors for Security and Bioterrorism Applications, pp.1-13, 2016.

J. L. Seachrist, beta sub2 -Adrenergic receptor internalization, endosomal sorting and plasma membrane recycling are regulated by Rab GTPases, J. Biol. Chem, vol.14, 2000.

M. Sealey-cardona, K. Schmidt, L. Demmel, T. Hirschmugl, T. Gesell et al., Sec16 Determines the Size and Functioning of the Golgi in the Protist Parasite, Trypanosoma brucei. Traffic, vol.15, pp.613-629, 2014.

M. N. Seaman, Cargo-selective endosomal sorting for retrieval to the Golgi requires retromer, J. Cell Biol, vol.165, pp.111-122, 2004.

T. Secher, A. Shima, K. Hinsinger, J. C. Cintrat, L. Johannes et al., Retrograde trafficking inhibitor of Shiga toxins reduces morbidity and mortality of mice infected with enterohemorrhagic Escherichia coli, Antimicrob. Agents Chemother, vol.59, pp.5010-5013, 2015.

P. Sengupta, P. Satpute-krishnan, A. Y. Seo, D. T. Burnette, G. H. Patterson et al., ER trapping reveals Golgi enzymes continually revisit the ER through a recycling pathway that controls Golgi organization, Proc. Natl. Acad. Sci, vol.112, pp.6752-6761, 2015.

H. J. Sharpe, T. J. Stevens, and S. Munro, A Comprehensive Comparison of Transmembrane Domains Reveals Organelle-Specific Properties, Cell, vol.142, pp.158-169, 2010.

D. A. Shaywitz, P. J. Espenshade, R. E. Gimeno, and C. A. Kaiser,

P. Shindiapina and C. Barlowe, Requirements for transitional endoplasmic reticulum site structure and function in Saccharomyces cerevisiae, Mol Biol Cell, vol.21, pp.1530-1545, 2010.

J. Shorter, M. B. Beard, J. Seemann, A. Barbara-dirac-svejstrup, and G. Warren, Sequential tethering of Golgins and catalysis of SNAREpin assembly by the vesicle-tethering protein p115, J. Cell Biol, vol.157, pp.45-62, 2002.

B. M. Simmons, P. D. Stahl, and J. H. Russell, Mannose receptor-mediated uptake of ricin toxin and ricin A chain by macrophages. Multiple intracellular pathways for a chain translocation, J. Biol. Chem, vol.261, pp.7912-7920, 1986.

B. Sinha, D. Köster, R. Ruez, P. Gonnord, M. Bastiani et al., Cells respond to mechanical stress by rapid disassembly of caveolae, Cell, vol.144, pp.402-413, 2011.
URL : https://hal.archives-ouvertes.fr/hal-00821331

D. Sissoko, C. Laouenan, E. Folkesson, A. B. Lebing, A. H. Beavogui et al.,

J. L. Conde, G. Gala, H. Colin, J. A. Savini, F. L. Bore et al.,

E. Poelart, J. M. Berbain, S. Dindart, A. Duraffour, T. Lefevre et al.,

S. Milinouno, A. Y. Ombelet, I. Sidiboun, P. Verreckt, A. Yombouno et al.,

M. Kerber, A. D. Gabriel, R. Caro, J. Wölfel, M. Badir et al., Experimental Treatment with Favipiravir for Ebola Virus Disease (the JIKI Trial): A Historically Cont rolled, Single-Arm Proof-of-Concept Trial in Guinea, PLoS Med, vol.13, pp.1-36, 2016.

G. Sivan, S. E. Martin, T. G. Myers, E. Buehler, K. H. Szymczyk et al., Human genome-wide RNAi screen reveals a role for nuclear pore proteins in poxvirus morphogenesis, Proc. Natl. Acad. Sci, vol.110, pp.3519-3524, 2013.

G. Sivan, A. S. Weisberg, J. L. Americo, and B. Moss, Retrograde Transport from Early Endosomes to the trans -Golgi Network Enables Membrane Wrapping and Egress of Vaccinia Virus Virions, J. Virol, vol.90, pp.8891-8905, 2016.

P. Van-der-sluijs, M. Hull, P. Webster, P. Mâle, B. Goud et al., The small GTP-binding protein rab4 controls an early sorting event on the endocytic pathway, Cell, vol.70, p.90307, 1992.

G. L. Smith, A. Vanderplasschen, and M. Law, The formation and function of extracellular enveloped vaccinia virus, J. Gen. Virol, vol.83, pp.2915-2931, 2002.

M. D. Snider and O. C. Rogers, Intracellular movement of cell surface receptors after endocytosis: Resialylation of asialo-transferrin receptor in human erythroleukemia cells, J. Cell Biol, vol.100, pp.826-834, 1985.

O. Söderberg, M. Gullberg, M. Jarvius, K. Ridderstråle, K. Leuchowius et al.,

. Landegren, Direct observation of individual endogenous protein complexes in situ by proximity ligation, Nat. Methods, vol.3, pp.995-1000, 2006.

T. Söllner, S. W. Whiteheart, M. Brunner, H. Erdjument-bromage, S. Geromanos et al., SNAP receptors implicated in vesicle targeting and fusion, Nature, vol.362, pp.318-324, 1993.

B. Sönnichsen, S. De-renzis, E. Nielsen, J. Rietdorf, and M. Zerial, Distinct membrane domains on endosomes in the recycling pathway visualized by multicolor imaging of Rab4, Rab5, and Rab11, J. Cell Biol, vol.149, pp.901-913, 2000.

A. Sorkin, M. Mazzotti, T. Sorkina, L. Scotto, and L. Beguinot, Epidermal Growth Factor Receptor Interaction with Clathrin Adaptors Is Mediated by the Tyr 974 -containing Internalization Motif *, J. Biol. Chem, vol.271, pp.13377-13384, 1996.

A. Spang, Anniversary of the discovery of sec mutants by Novick and Schekman, Mol. Biol. Cell, vol.26, pp.1783-1785, 2015.

R. A. Spooner and J. M. Lord, How ricin and Shiga toxin reach the cytosol of target cells: Retrotranslocation from the endoplasmic reticulum, Curr. Top. Microbiol. Immunol, vol.357, pp.19-40, 2012.

R. A. Spooner, P. Watson, D. C. Smith, F. Boal, M. Amessou et al., The secretion inhibitor Exo2 perturbs trafficking of Shiga toxin between endosomes and the trans -Golgi network, Biochem. J, vol.414, pp.471-484, 2008.
URL : https://hal.archives-ouvertes.fr/hal-00478957

J. Sprangers and C. Rabouille, SEC16 in COPII coat dynamics at ER exit sites, Biochem. Soc. Trans, vol.43, pp.97-103, 2015.

S. M. Stagg, C. Gürkan, D. M. Fowler, P. Lapointe, T. R. Foss et al., Structure of the Sec13/31 COP II coat cage, Nature, vol.439, pp.234-238, 2006.

B. Stechmann, S. K. Bai, E. Gobbo, R. Lopez, G. Merer et al., Inhibition of retrograde transport protects mice from lethal ricin challenge, Cell, vol.141, pp.231-242, 2010.
URL : https://hal.archives-ouvertes.fr/hal-00509058

P. E. Stein, G. J. Boodhoo, J. L. Tyrrell, R. J. Brunton, and . Read, Crystal structure of the cell-binding B oligomer of verotoxin-1 from E. coli, Nature, vol.355, pp.748-750, 1992.

F. Stirpe, Ribosome-inactivating proteins, Molecular Neurosurgery With Targeted Toxins, 2005.

W. Stoorvogel, V. Oorschot, and H. J. Geuze, A novel class of clathrin-coated vesicles budding from endosomes, J. Cell Biol, vol.132, pp.21-33, 1996.

S. Sundar, A. Singh, and O. P. Singh, Strategies to overcome antileishmanial drugs unresponsiveness, J. Trop. Med, 2014.

F. Supek, D. T. Madden, S. Hamamoto, L. Orci, and R. Schekman, Sec16p potentiates the action of COPII proteins to bud t ransport vesicles, J. Cell Biol, vol.158, pp.1029-1038, 2002.

R. B. Sutton, D. Fasshauer, R. Jahn, and A. T. Brunger, Crystal structure of a SNARE complex involved in synaptic exocytosis at 2.4 A resolution, Nature, vol.395, pp.347-353, 1998.

S. M. Sweitzer and J. E. Hinshaw, Dynamin undergoes a GTP-dependent conformational change causing vesiculation, Cell, vol.93, pp.81207-81213, 1998.

G. Tai, L. Lu, T. L. Wang, B. L. Tang, B. Goud et al., Participation of the Syntaxin 5/Ykt6/GS28/GS15 SNARE Complex in Transport from the Early/Recycling Endosome to the Trans-Golgi Network ? D, Mol. Biol. Cell, vol.15, pp.4011-4022, 2004.

P. A. Takizawa, J. K. Yucel, B. Veit, D. J. Faulkner, T. Deerinck et al., Complete vesiculation of Golgi membranes and inhibition of protein transport by a novel sea sponge metabolite, ilimaquinone. Cell, vol.73, issue.93, pp.90638-90645, 1993.

B. L. Tang, D. Y. Low, S. S. Lee, A. E. Tan, and W. Hong, Molecular cloning and localization of human syntaxin 16, a member of the syntaxin family of SNARE proteins, Biochem. Commun, vol.242, pp.673-679, 1998.

P. I. Tarr, C. A. Gordon, and W. L. Chandler, Shiga-toxin-producing Escherichia coli and haemolytic uraemic syndrome, Lancet, vol.365, pp.1073-1086, 2005.

R. Tewari, C. Bachert, and A. D. Linstedt, Induced oligomerization targets Golgi proteins for degradation in lysosomes, Mol. Biol. Cell, vol.26, pp.4427-4437, 2015.

R. Tewari, T. Jarvela, and A. D. Linstedt, Manganese induces oligomerization to promote down-regulation of the intracellular trafficking receptor used by Shiga toxin, Mol. Biol. Cell, vol.25, pp.3049-3058, 2014.

W. L. Thompson, J. P. Scovill, and J. G. Pace, Drugs that show protective effects from ricin toxicity in in vitro protein synthesis assays, Nat. Toxins, vol.3, pp.369-377, 1995.

C. W. Tornøe, C. Christensen, and M. Meldal, Triazoles by regiospecific copper(I)-catalyzed 1,3-dipolar cycloadditions of terminal alkynes to azides, J. Org. Chem, vol.67, pp.3057-3064, 2002.

A. F. Trofa, H. Ueno-olsen, R. Oiwa, and M. Yoshikawa, Dr. Kiyoshi Shiga: Discoverer of the Dysentery Bacillus, vol.29, pp.1303-1306, 1999.

P. K. Umasankar, S. Sanker, J. R. Thieman, S. Chakraborty, B. Wendland et al., Distinct and separable activities of the endocytic clathrin-coat components Fcho1/2 and AP-2 in developmental patterning, Nat. Cell Biol, vol.14, pp.488-501, 2012.

E. Ungewickell, H. Ungewickell, S. E. Holstein, R. Lindner, K. Prasad et al., Role of auxilin in uncoating clathrin-coated vesicles, Nature, vol.378, pp.632-635, 1995.

A. Utskarpen, H. H. Slagsvold, A. B. Dyve, S. S. Skånland, and K. Sandvig, SNX1 and SNX2 mediate retrograde transport of Shiga toxin, Biochem. Biophys. Res. Commun, vol.358, pp.566-570, 2007.

R. Vancini, G. Wang, D. Ferreira, R. Hernandez, and D. T. Brown, Alphavirus Genome Delivery Occurs Directly at the Plasma Membrane in a Time-and Temperature-Dependent Process, J. Virol, vol.87, pp.4352-4359, 2013.

T. Waddell, A. Cohentt, and C. A. Lingwood, Induction of verotoxin sensitivity in receptor-deficient cell lines using the receptor glycolipid globotriosylceramide, Cell Biol, vol.87, pp.7898-7901, 1990.

P. G. Wahome, Y. Bai, L. M. Neal, J. D. Robertus, and N. J. Mantis, Identification of small-molecule inhibitors of ricin and shiga toxin using a cell-based high-throughput screen, Toxicon, vol.56, pp.313-323, 2010.

T. A. Walsh, A. E. Morgan, and T. D. Hey, Characterization and molecular cloning of a proenzyme form of a ribosome-inactivating protein from maize: Novel mechanism of proenzyme activation by proteolytic removal of a 2.8-kilodalton internal peptide segment, J. Biol. Chem, vol.266, pp.23422-23427, 1991.

J. Wang and K. E. Howell, The luminal domain of TGN38 interacts with integrin beta 1 and is involved in its traffickin g, Traffic, vol.1, pp.713-736, 2000.

T. H. Ward, R. S. Polishchuk, S. Caplan, K. Hirschberg, and J. Lippincott-schwartz, Maintenance of Golgi structure and function depends on the integrity of ER export, J. Cell Biol, vol.155, pp.557-570, 2001.

S. Watanabe and E. Boucrot, Fast and ultrafast endocytosis, Curr. Opin. Cell Biol, vol.47, pp.64-71, 2017.

P. Watson, A. K. Townley, P. Koka, K. J. Palmer, and D. J. Stephens, Sec16 defines endoplasmic reticulum exit sites and is required for secretory cargo export in mammalian cells, Traffic, vol.7, pp.1678-1687, 2006.

T. Weber, B. V. Zemelman, J. A. Mcnew, B. Westermann, M. Gmachl et al., SNAREpins: Minimal machinery for membrane fusion, Cell, vol.92, pp.759-772, 1998.

J. R. Van-weering, R. B. Sessions, C. J. Traer, D. P. Kloer, V. K. Bhatia et al., Cull en. 2012. Molecular basis for SNX-BAR-mediated assembly of distinct endosomal sorting tubules, EMBO J, vol.31, pp.4466-4480

J. White and A. Helenius, pH-dependent fusion between the Semliki Forest virus membrane and liposomes, Proc. Natl. Acad. Sci, vol.77, pp.3273-3277, 1980.

J. R. Whittle and T. U. Schwartz, Structure of the Sec13-Sec16 edge element, a template for assembly of the COPII vesicle coat, J. Cell Biol, vol.190, pp.347-361, 2010.

J. R. Whyte and S. Munro, Vesicle tethering complexes in membrane traffic, J. Cell Sci, vol.115, pp.2627-2637, 2002.

C. Wimmer, T. M. Hohl, C. A. Hughes, S. A. Müller, T. H. Söllner et al., Molecular Mass, Stoichiometry, and Assembly of 20 S Particles, J. Biol. Chem, vol.276, pp.29091-29097, 2001.

K. Witte, A. L. Schuh, J. Hegermann, A. Sarkeshik, J. R. Mayers et al., TFG -1 function in protein secretion and oncogenesis, Nat. Cell Biol, vol.13, pp.550-558, 2011.

G. Wittig and R. Pohlke, Zur Existenz niedergliedriger Cycloalkine, II, Chem. Ber, vol.94, pp.3276-3286, 1961.

Y. Xu, GS15 Forms a SNARE Complex with Syntaxin 5, GS28, and Ykt6 and Is Implicated in Traffic in the Early Cisternae o f the Golgi Apparatus, Mol. Biol. Cell, vol.13, pp.3493-3507, 2002.

E. Yamada, the Fine Structure of the Gall Bladder Epithelium of the Mouse, J. Cell Biol, vol.1, pp.445-458, 1955.

Y. Yamauchi and A. Helenius, Virus entry at a glance, J. Cell Sci, vol.126, pp.1289-1295, 2013.

J. C. Yarrow, Y. Feng, Z. E. Perlman, T. Kirchhausen, and T. J. Mitchison, Phenotypic screening of small molecule librari es by high throughput cell imaging, Comb. Chem. High Throughput Screen, vol.6, pp.279-286, 2003.

S. Yonekawa, A. Furuno, T. Baba, Y. Fujiki, Y. Ogasawara et al., Sec16B is involved in the endoplasmic reticulum export of the peroxisomal membrane biogenesis factor peroxin 16 (Pex16) in mammalian cells, Proc. Natl. Acad. Sci. U. S. A, vol.108, pp.12746-51, 2011.

T. Yorimitsu and K. Sato, Insights into structural and regulatory roles of Sec16 in COPII vesicle formation at ER exit sites, Mol. Biol. Cell, vol.23, pp.2930-2942, 2012.

T. Yoshida, C. Chen, M. Zhang, and H. C. Wu, Disruption of the Golgi apparatus by brefeldin A inhibits the cytotoxicity of ricin, modeccin, and Pseudomonas toxin, Exp. Cell Res, vol.192, pp.389-395, 1991.

T. Yoshihisa, C. Barlowe, and R. Schekman, Requirement for a GTPase-activating protein in vesicle budding from the endoplasmic reticulum. Science (80-. ), vol.259, pp.1466-1468, 1993.

J. Z. Zhang, B. A. Davletov, T. C. Südhof, and R. G. Anderson, Synaptotagmin I is a high affinity receptor for clathrin AP-2: Implications for membrane recycling, Cell, vol.78, pp.90442-90443, 1994.

, Alexandre Bobard 6 , Henri-François Renard 1,2,3, Stefan J. Rathjen, vol.5, issue.3

. Inserm-u1143,

. Inserm-u970, P. Parcc-universitéparis-descartes-sorbonne, and . Cité, , vol.75006

A. Ho?pital-européen-georges-pompidou, . Service-d'immunologie, and . Biologique, Paris Cedex, vol.15, p.75908

, Dynamique des Interactions Ho?te Pathoge?ne, Institut Pasteur, vol.15, p.75724

, While the retrograde transport process has been well characterized, the contribution of microRNAs (miRNAs) in regulating this cellular transport mechanism remains unknown. Here, we identified that the intronic miRNA family, miR-199a/b, coordinate genes regulating retrograde transport (RT) and endosome trafficking. In particular, we demonstrate that miR-199a-5p attenuates the expression Vps26A

, Importantly, we found that overexpression of Vps26A construct resistant to the miRNA action abolish the effect of miR-199a-5p on RT. Finally, we demonstrate that miR-199-5p transfection attenuates shiga toxin (STxB)-mediated inhibition of protein biosynthesis. In summary, our work identifies the first non-coding RNA that influences RT and suppresses the cytotoxicity caused by bacterial toxins

, Importantly, mutations in the miRNA seed sequence binding sites (Fig. 1c-d), release the repression of Vps26A and Rab9B 3'UTR activity, consistent with a direct interaction of miR-199a-5p with these sites. Surprisingly, 199a-5p (Fig. 1c)

. Vps26a, As expected by the inhibitory effect of miR-199-5p on 3'UTR luciferase activity, miR-199a-5p overexpression significantly attenuated Vps26A and Rab9B mRNA and protein expression (Fig. 1e and Fig. 1f). In addition to Vps26 and Rab9B, we observed that miR-199b-5p overexpression also decreases Rab7A mRNA and protein expression, suggesting that miR-199a-5p might influence Rab7A expression by an indirect mechanism. We further assessed whether miR-199-5p inhibition enhances Vps26A, Rab9B, Rab7A and SNX6 mRNA expression. Importantly, we found that miR-199a-5p antagonism in vitro increase the expression of these genes, suggesting that the endogenous expression of miR-199b-5p influences Vps26A, Rab9B, Rab7A and SNX6 expression (Fig. 1g). Taken together, these results suggest that miR-199a

, MiR-199a-5p impairs intracellular retrograde transport

. Popoff, We next characterize the intracellular localization of STxB in cells transfected with miR-199-5p mimics and found that miR-199a-5p enhances the co-localization of Cy3-STxB with EEA1, an early endosome marker, suggesting that miR-199a-5p impairs the transport from early endosomes to the Golgi (Fig. 2b and d). Interestingly, when we analyzed the Golgi structure in miR-199a-5p transfected cells, we observed an increased Golgi fragmentation compared with CM treated cells (Fig. 2a, arrowheads). the Golgi protein, GM130. As shown in fig. 2f, miR-199athe retromer (Lieu and Gleeson, 2010) therefore, to gain insights into the molecular mechanism by which miR-199a-5p controls RT, we assessed whether Vps26A overexpression could rescue the effect of miR-199a-5p on RT. To this end, we transfected HeLa cells with vector-GFP (control) or Vps26A-GFP that lacked the 3' UTR sequence, thus resistant J to miR-199a-5p inhibitory action. The results showed that both GFP and Vps26A-GFP expressing cells transfected with CM internalized Cy3-STxB and accumulated in perinuclear membranes that were labeled by GM130 (Fig. 3a, upper panels), STxB binds to the glycolipid globotriaosylceramide (Gb3), its cellular receptor, and it is further internalized from endosomes to TGN, 1994.

, Next, we wondered whether miR-199a-5p might also influence the RT of an endogenous protein

. Ganley, We also observed that steady-state localization of ectopic Vps26A-GFP, Therefore, we tested whether miR-199a-5p influences the intracellular trafficking of TGN46, a transmembrane glycosylated protein that is localized to the TGN and cycles between the TGN and the plasma membrane, 2008.

. Prescott, In contrast to cells transfected with CM, miR-199a-5p overexpression results in TGN46 and GM130 dispersion in the cell periphery, confirming Golgi fragmentation (Fig. 4a, panel 3). Because the Golgi complex, the mature protein has an apparent molecular mass of ~110 kDa (Fig. 4b), 1997.

, Interestingly, we found that miR-199a-5p overexpression results in a significant reduction of TGN46 molecular weight (~80 kDa), suggesting that miR-199a-5p impairs TGN46 transport between ER to Golgi, and leading to a reduced glycosylation (Fig. 4b, second line and 4d), M6PR monoclonal antibody was purchase from Calbiochem. A rabbit antibody to Cathepsin D was from Epitomics. The monoclonal anti-actin antibody was from Sigma

R. Red-lysotracker and ;. Mallard, MiRNA mimics and inhibitors were obtained from Dharmacon. The Vps26A-GFP plasmid was kindly provided by Prof, Cy3-STxB was obtained as described in, 1998.

, Cervix carcinoma (HeLa) and monkey kidney fibroblast (COS7) cells were obtained from American Type Tissue Collection (ATCC) and were maintained in Dulbecco's

H. Da, ), which provides target interaction information from eight different prediction algorithms. Specifically, the programs miRanda, miRWalk and TargetScan were used. The putative targets produced by all three of these algorithms for miR-199a-5p were uploaded into the gene classification system, Target mRNA for hsa-miR-199a/b were identified and compared using the online target prediction algorithm, miRWalk, 2009.

, Total RNA was isolated using TRIzol reagent (Invitrogen) according to the manufacturer's protocol

, following the manufacturer's protocol. Quantitative real-time PCR (qRT-PCR) analysis was performed in triplicate using iQ SYBR green Supermix (BioRad) on an iCycler Real-Time Detection System (Eppendorf). The mRNA level was normalized to GAPDH (glyceraldehyde-3-phosphate dehydrogenase) as a house keeping gene. The human primer sequences used were: GAPDH, cDNA was synthesized using iScript RT Supermix, vol.5

. Aranda, GTGTGCCGGGAAGCTGGCAA -3' and 5'-CCACGCTCCTCAGACACAGGGT -3'; Rab9B 5'-AGCCAGAACTGGGACCCCACA -3' and 5'-AGGCCCCAGGTCTCATGCACT -3'; Vps26A 5'-TGCTTGTTGATGAGGAAGACCGGAG -3' and 5'-previously described, briefly, cells were lysed in ice-cold buffer containing 50 mM Tris-HCl, pH 7.5, 125 mM NaCl, 1 % NP-40, 5.3 mM NaF, 1.5 mM NaP, 1 mM orthovanadate and 1 mg/ml of protease inhibitor cocktail, 2015.

, Schematic representation of genomic location of DNM2 gene and intronic miR-199a1. (B) Gene ontology analysis of the predicted miR-199a/b target genes using Panther software. A protein-protein interaction analysis scheme of selected predicted miR-199a-5p target genes using String 9.1 software and Navigator 2.2. is shown. Retrograde transport protein coding genes are highlighted in red (C-D) Luciferase reporter activity in COS7 cells transfected with control mimic or miR-199a-5p mimic and the indicated human 3? UTR containing or not (wild-type, WT) the indicated point mutation in the target miR-199a-5p-binding sites. (E) Gene expression analyses (qRT-PCR) of Vps26A, Rab9B, Rab7A and SNX6 expression in HeLa cells transfected with non-targeting control mimic (CM) and miR-199a-5p mimic (F), MiR-199a is encoded in DNM loci genomic location regulates the expression of genes associated to the retrograde transport. (A)

, Western blot analysis of GM130, EEA1 and Vps26A in cells transfected with CM and miR-199a-5p. Quantification of the relative amounts of proteins on experiments is shown in right panel. The means±SEM of three independent experiments are shown. (G) HeLa cells were transfected 48 h with CM (black data points) and miR-199a-5p (red data points) before addition of Shiga toxin 1h. Intoxication of HeLa cells is shown. Each point corresponds to the mean±SEM of a representative experiment out of two to three determinations. (H) Protection factors calculated over the indicated number of experiments. Means±SEM are shown. The p-Value was calculated using the t-test. *P?0.05 Scale bars=15 ?M Figure 4. Vps26A is necessary for TGN46 Retrograde transport. (A) HeLa cells co-transfected as indicated, CM and Vps26A-GFP in upper panel and miR-199a-5p and Vps26A-GFP in lower panel during 48 h. Cells were fixed and labeled for GM130 and DAPI and their steady state localization were observed and shown in Z-projections of confocal stacks. (B) HeLa cells transfected as indicated (CM/EGFP, miR-199a-5p/EGFP, CM/Vps26A-GFP and miR-199a-5p/Vps26A-GFP) were analyzed by western blot for TGN46, Figure 2. miR-199a-5p regulates Shiga toxin internalization and protect against intoxication in HeLa cells. (A) CM and miR-199a-5p transfected cells during 48 h were incubated with Cy3-STxB (5 ?g/mL) on ice, which were then shifted to 37°C for 30 min (upper panel) and 60 min (lower panel). (B) HeLa cells treated as (A) and incubated with Cy3-STxB

, *P?0.05 and # P>0.05

, Confocal microscopy inmunofluorescence images showing subcellular localization of CD63 (green) subjected to 30 min Red-Lysotracker internalization at 37ºC in HeLa cells transfected as indicated. Magnification insets are shown in the right panel. (B) Flow cytometry analysis Red-Lysotracker internalization at 37ºC in HeLa cells treated as in (A), Figure 6. MiR-199a-5p regulate endolysosomal trafficking. (A)

, Data are expressed as fold change of Gmean±SEM. (D) HeLa cells were treated transfected with CM and miR-199a-5p. 24 h after transfection, cells were rinsed with PBS and incubated in serum-free culture medium for 24 h. The medium was collected and precipitated with trichloroacetic acid (TCA), and the resulting pellets were analyzed by 4 -20 % acrylamide gradient SDS-PAGE and immunoblotted with rabbit polyclonal antibody against cathepsin D. Blots were also probed with antibody to Hsp90 as a loading control. The positions of molecular mass markers (KDa) and of the precursor (pCatD), intermediate (iCatD), and mature (mCatD) forms of cathepsin D are indicated. Quantification of 3 independent experiments is shown in histograms in the lower panel. (E) Western blot analysis of EGFR, p62, LC3B-I/LC3B-II and Vps26A proteins levels in CM and miR-199a-5p transfected cells. Quantification is shown in right panel. (F) Confocal immunofluorescence analysis of LC3 in HeLa cells treated as indicated. (G) EGFR degradation assay in EGF-stimulated HeLa cells transfected with CM and miR-199a-5p, Flow cytometry of CM or miR-199a-5p transfected HeLa cells that were cultured in presence of 200 ?g/ml fluorescence DQ-BSA-green for 1 h at 37°C and incubated at 37°C for 2 h

M. Amessou, D. Carrez, D. Patin, M. Sarr, D. S. Grierson et al., Retrograde delivery of photosensitizer (TPPp-O-beta-GluOH)3 selectively potentiates its photodynamic activity, Bioconjugate chemistry, vol.19, pp.532-538, 2008.
URL : https://hal.archives-ouvertes.fr/inserm-00256856

J. F. Aranda, A. Canfran-duque, L. Goedeke, Y. Suarez, and C. Fernandez-hernando, The miR-199-dynamin regulatory axis controls receptor-mediated endocytosis, Journal of cell science, vol.128, pp.3197-3209, 2015.

C. N. Arighi, L. M. Hartnell, R. C. Aguilar, C. R. Haft, and J. S. Bonifacino, Role of the mammalian retromer in sorting of the cationindependent mannose 6-phosphate receptor, The Journal of cell biology, vol.165, pp.123-133, 2004.

S. Bolte and F. P. Cordelieres, A guided tour into subcellular colocalization analysis in light microscopy, Journal of microscopy, vol.224, pp.213-232, 2006.
URL : https://hal.archives-ouvertes.fr/hal-00132481

J. S. Bonifacino and R. Rojas, Retrograde transport from endosomes to the trans-Golgi network, Nature reviews Molecular cell biology, vol.7, pp.568-579, 2006.

B. P. Ceresa and S. J. Bahr, rab7 activity affects epidermal growth factor:epidermal growth factor receptor degradation by regulating endocytic trafficking from the late endosome, The Journal of biological chemistry, vol.281, pp.1099-1106, 2006.

P. Z. Chia, I. Gasnereau, Z. Z. Lieu, and P. A. Gleeson, Rab9-dependent retrograde transport and endosomal sorting of the endopeptidase furin, Journal of cell science, vol.124, pp.2401-2413, 2011.

P. Z. Chia and P. A. Gleeson, The regulation of endosome-to-Golgi retrograde transport by tethers and scaffolds, Traffic, vol.12, pp.939-947, 2011.

K. Deinhardt, S. Salinas, C. Verastegui, R. Watson, D. Worth et al., Rab5 and Rab7 control endocytic sorting along the axonal retrograde transport pathway, Neuron, vol.52, pp.293-305, 2006.

B. Dong, K. Kakihara, T. Otani, H. Wada, and S. Hayashi, Rab9 and retromer regulate retrograde trafficking of lum inal protein required for epithelial tube length control, Nature communications, vol.4, 1358.

I. G. Ganley, E. Espinosa, and S. R. Pfeffer, A syntaxin 10-SNARE complex distinguishes two distinct transport routes from endosomes to the trans-Golgi in human cells, The Journal of cell biology, vol.180, pp.159-172, 2008.

A. Hierro, D. C. Gershlick, A. L. Rojas, and J. S. Bonifacino, Formation of Tubulovesicular Carriers from Endosomes a nd Their Fusion to the trans-Golgi Network, International review of cell and molecular biology, vol.318, pp.159-202, 2015.

A. Hierro, A. L. Rojas, R. Rojas, N. Murthy, G. Effantin et al., Functional architecture of the retromer cargo-recognition complex, Nature, vol.449, pp.1063-1067, 2007.

W. Huang-da, B. T. Sherman, and R. A. Lempicki, Systematic and integrative analysis of large gene lists using DAVID bioinformatics resources, Nat Protoc, vol.4, pp.44-57, 2009.

J. Huotari and A. Helenius, Endosome maturation. The EMBO journal, vol.30, pp.3481-3500, 2011.

S. Jager, C. Bucci, I. Tanida, T. Ueno, E. Kominami et al., Role for Rab7 in maturation of late autophagic vacuoles, Journal of cell science, vol.117, pp.4837-4848, 2004.

L. Johannes and V. Popoff, Tracing the retrograde route in protein trafficking, Cell, vol.135, pp.1175-1187, 2008.

R. Kuliawat, J. Klumperman, T. Ludwig, A. , and P. , Differential sorting of lysosomal enzymes out of the regulate d secretory pathway in pancreatic beta-cells, The Journal of cell biology, vol.137, pp.595-608, 1997.

O. Laufman, W. Hong, L. , and S. , The COG complex interacts directly with Syntaxin 6 and positively regulates endosome-to-TGN retrograde transport, The Journal of cell biology, vol.194, pp.459-472, 2011.

Z. Z. Lieu, M. C. Derby, R. D. Teasdale, C. Hart, P. Gunn et al., The golgin GCC88 is required for efficient retrograde transport of cargo from the early endosomes to the trans-Golgi network, Molecular biology of the cell, vol.18, pp.4979-4991, 2007.

Z. Z. Lieu and P. A. Gleeson, Identification of different itineraries and retromer components for endosome-to-Golgi transport of TGN38 and Shiga toxin, European journal of cell biology, vol.89, pp.379-393, 2010.

T. T. Liu, T. S. Gomez, B. K. Sackey, D. D. Billadeau, and C. G. Burd, Rab GTPase regulation of ret romer-mediated cargo export during endosome maturation, Molecular biology of the cell, vol.23, pp.2505-2515, 2012.

T. Ludwig, C. E. Ovitt, U. Bauer, M. Hollinshead, J. Remmler et al., Targeted dis ruption of the mouse cation-dependent mannose 6-phosphate receptor results in partial missorting of multiple lysosomal enzymes, The EMBO journal, vol.12, pp.5225-5235, 1993.

J. R. Lytle, T. A. Yario, and J. A. Steitz, Target mRNAs are repressed as efficiently by microRNA-binding sites in the 5' UTR as in the 3' UTR, Proceedings of the National Academy of Sciences of the United States of America, vol.104, pp.9667-9672, 2007.

F. Mallard, C. Antony, D. Tenza, J. Salamero, B. Goud et al., Direct pathway from early/recycling endosomes to the Golgi apparatus revealed through the study of shiga toxin B-fragment transport, The Journal of cell biology, vol.143, pp.973-990, 1998.

K. Mcgourty, T. L. Thurston, S. A. Matthews, L. Pinaud, L. J. Mota et al., Salmonella inhibits retrograde trafficking of mannose-6-phosphate receptors and lysosome function, Science, vol.338, pp.963-967, 2012.

G. R. Medigeshi and P. Schu, Characterization of the in vitro retrograde transport of MPR46, Traffic, vol.4, pp.802-811, 2003.

Y. Nishida, S. Arakawa, K. Fujitani, H. Yamaguchi, T. Mizuta et al., Discovery of Atg5/Atg7-independent alternative macroautophagy, Nature, vol.461, pp.654-658, 2009.

F. J. Perez-victoria, G. A. Mardones, and J. S. Bonifacino, Requirement of the human GARP complex for mannose 6-phosphatereceptor-dependent sorting of cathepsin D to lysosomes, Molecular biology of the cell, vol.19, pp.2350-2362, 2008.

V. Popoff, G. A. Mardones, D. Tenza, R. Rojas, C. Lamaze et al., The retromer complex and clathrin define an early endosomal retrograde exit site, Journal of cell science, vol.120, pp.2022-2031, 2007.

A. R. Prescott, J. M. Lucocq, J. James, J. M. Lister, and S. Ponnambalam, Distinct compartmentalization of TGN46 and beta 1,4-galactosyltransferase in HeLa cells, European journal of cell biology, vol.72, pp.238-246, 1997.

B. Ravikumar, S. Imarisio, S. Sarkar, C. J. O'kane, and D. C. Rubinsztein, Rab5 modulates aggregation and toxicity of mutant huntingtin through macroautophagy in cell and fly models of Huntington disease, Journal of cell science, vol.121, pp.1649-1660, 2008.

R. Rojas, S. Kametaka, C. R. Haft, and J. S. Bonifacino, Interchangeable but essential functions of SNX1 and SNX2 in the association of retromer with endosomes and the trafficking of mannose 6-phosphate receptors, Molecular and cellular biology, vol.27, pp.1112-1124, 2007.

R. Rojas, T. Van-vlijmen, G. A. Mardones, Y. Prabhu, A. L. Rojas et al., Regulation of retromer recruitment to endosomes by sequential action of Rab5 and Rab7, The Journal of cell biolo gy, vol.183, pp.513-526, 2008.

K. Sandvig, O. Garred, K. Prydz, J. V. Kozlov, S. H. Hansen et al., Retrograde transport of endocytosed Shiga toxin to the endoplasmic reticulum, Nature, vol.358, pp.510-512, 1992.

K. Sandvig, M. Ryd, O. Garred, E. Schweda, P. K. Holm et al., Retrograde transport from the Golgi comp lex to the ER of both Shiga toxin and the nontoxic Shiga B-fragment is regulated by butyric acid and cAMP, The Journal of cell biology, vol.126, pp.53-64, 1994.

M. N. Seaman, Cargo-selective endosomal sorting for retrieval to the Golgi requires retromer, The Journal of cell biology, vol.165, pp.111-122, 2004.

Y. Shiba, S. Kametaka, S. Waguri, J. F. Presley, and P. A. Randazzo, ArfGAP3 regulates the transport of cation-independent mannose 6-phosphate receptor in the post-Golgi compartment, Current biology : CB, vol.23, pp.1945-1951, 2013.

Y. Shiba, W. Romer, G. A. Mardones, P. V. Burgos, C. Lamaze et al., AGAP2 regulates retrograde transport between early endosomes and the TGN, vol.123, pp.2381-2390, 2010.

M. Sohda, Y. Misumi, A. Yamamoto, N. Nakamura, S. Ogata et al., Interaction of Golgin-84 with the COG complex mediates the intra-Golgi retrograde transport, Traffic, vol.11, pp.1552-1566, 2010.

P. A. Thibault, A. Huys, Y. Amador-canizares, J. E. Gailius, D. E. Pinel et al., Regulation of Hepatitis C Virus Genome Replication by Xrn1 and MicroRNA-122 Binding to Individual Sites in the 5' Untranslated Region, Journal of virology, vol.89, pp.6294-6311, 2015.

V. A. Van-rahden, K. Brand, J. Najm, J. Heeren, S. R. Pfeffer et al., , 2012.

J. R. Van-weering, P. Verkade, and P. J. Cullen, SNX-BAR-mediated endosome tubulation is co-ordinated with endosome maturation, Traffic, vol.13, pp.94-107, 2012.

T. Wassmer, N. Attar, M. V. Bujny, J. Oakley, C. J. Traer et al., A loss-of-function screen reveals SNX5 and SNX6 as potential components of the mammalian retromer, Journal of cell science, vol.120, pp.45-54, 2007.

N. Xu, J. Zhang, C. Shen, Y. Luo, L. Xia et al., Cisplatin-induced downregulation of miR-199a-5p increases drug resistance by activating autophagy in HCC cell, Biochemical and biophysical research communications, vol.423, pp.826-831, 2012.

H. Yi, B. Liang, J. Jia, N. Liang, H. Xu et al., Differential roles of miR-199a-5p in radiation-induced autophagy in breast cancer cells, FEBS letters, vol.587, pp.436-443, 2013.